Preparation and application of Nrf2 gene deleted zebrafish mutant
A gene deletion, zebrafish technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of poisoning, no biological means, etc., and achieve the effect of good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0050] Example 1 Cas 9mRNA and gRNA synthesis
[0051] 1. CRISPR / Cas 9 gene knockout target design
[0052] 1. Experimental method
[0053] Find the genomic DNA sequence of the zebrafish nrf2 gene on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ). According to the design principle of CRISPR / Cas 9, the target sequence for the zebrafish nrf2 gene was designed. The designed nrf2 gene target sequence is GGTGGAGCTGCGCAGGCGGA (the nucleotide sequence is shown in SEQ ID NO: 1).
[0054] Design PCR primers for amplifying the nrf2 gene target, the primer sequences are: TGGCGGCAGGATGTGGATCT (nucleotide sequence shown in SEQ ID NO: 3) and GGCAGGAACTCTCCGGTCT (nucleotide sequence shown in SEQ ID NO: 4), from zebrafish A partial fragment of the nrf2 gene was obtained by PCR amplification in the genomic DNA to confirm the correctness of the target sequence.
[0055] 2. Experimental results
[0056] The nrf2 gene target was amplified and sequenced using the PCR primers for amplifying ...
Embodiment 2
[0072] Example 2 Validation of Microinjection of Zebrafish Embryos and Nrf2 Gene Knockout System
[0073] 1. Experimental method
[0074] The nrf2-gRNA (100ng / μL) prepared in Example 1 and Cas 9mRNA (300ng / μL) were mixed in equal volumes, prepared as an injection system, and the zebrafish one-cell stage (also known as the single-cell stage, which did not start after fertilization) was obtained. Split zygotes, here indicated by Roman numerals), were microinjected. After 3 days of injection, select part of normally developing embryos, extract genomic DNA, and use this as a template to amplify nrf2 gene fragments using primer nucleotide sequences shown in SEQ ID NO: 3-4.
[0075] The reaction conditions were 94°C for 3min; 94°C for 15s, 56°C for 15s, 72°C for 20s, 35 cycles; 72°C for 5min; 4°C∞. Send the products obtained by PCR to the sequencing company for sequencing, and judge the effectiveness of the knockout according to the sequencing peak map.
[0076] 2. Experimental r...
Embodiment 3
[0078] Example 3 Preparation of Nrf2 gene knockout zebrafish
[0079] 1. Preparation of F0 generation of Nrf2 gene knockout zebrafish
[0080] The verification in Example 2 is to initially verify whether the injected knockout system is effective in the juvenile stage, but it cannot ensure that each individual is effectively edited, so it is necessary to verify and screen the individuals one by one after they grow up.
[0081] 1. Experimental method
[0082] Breed the microinjected zebrafish obtained in Example 3 to adult fish, cut off the tail fin and extract genomic DNA, amplify the nrf2 gene fragment of each individual according to step 4, and perform sequencing according to the method in Example 2.
[0083] 2. Experimental results
[0084] After sequencing, it is determined that individuals with mutations are the F0 generation.
[0085] 2. Preparation of F1 generation of Nrf2 gene knockout zebrafish
[0086] 1. Experimental method
[0087] The F0 generation zebrafish s...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More