Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of enterotoxin gene lt knockout Escherichia coli and its construction method

A technology of Escherichia coli and construction method, which is applied in the field of gene knockout, can solve the problems of low efficiency of bacterial knockout, high degree of dependence, leaving FRT marks, etc., and achieves the effect of convenient and seamless knockout and slowing growth

Active Publication Date: 2021-11-05
ANIMAL SCI RES INST GUANGDONG ACADEMY OF AGRI SCI
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Bacterial genome knockout, especially Escherichia coli, usually uses the λ-Red system, which has the advantage of high knockout efficiency for bacteria, but the disadvantage is that the steps to achieve seamless knockout are cumbersome and will leave FRT marks
The advantage of Crispr / Cas9 is that it is easy to achieve traceless knockout, but it is highly dependent on the protospacer sequence adjacent motif (PAM sequence), and the knockout efficiency for some bacteria is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of enterotoxin gene lt knockout Escherichia coli and its construction method
  • A kind of enterotoxin gene lt knockout Escherichia coli and its construction method
  • A kind of enterotoxin gene lt knockout Escherichia coli and its construction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of LT gene homologous recombination donor LT donar

[0045] The full-length LT gene was cloned with the primers LT-F / LT-R in Table 1, connected to the TA-cloning vector, and transformed into competent cells. Select a single clone, sequence the positive clones verified and screened by PCR, and compare them to the NCBI database to obtain the full length of the LT gene and its upstream and downstream sequences. According to the LT gene and its upstream and downstream sequences, the 5'-end homology arm sequence L-arm short and L-arm, and the 3'-end homology arm sequence R-arm were designed. With DNA fragment Cat-chl cassette as the replacement gene of LT, the donor LThdonar (L-arm+Cat-chl cassette+L-arm short+R-arm) of synthetic LT gene (see image 3 ). The base sequence of LTh donar is as follows:

[0046] TTCATTTTTTTTATTTTATTAGCATCGCCATTATATGCAAATGGCGACAAATTATACCGTGCTGATTCATGT GCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGTTGATCG ...

Embodiment 2

[0054] Embodiment 2 LT donar conversion

[0055] Prepare electrotransfection competent cells containing the pCas-Red plasmid, inoculate the ETEC K88 positive clone containing the pCas-Red plasmid (see Figure 2) into 50 mL of LB liquid medium containing Amp and 1% glycerol, at 30°C, 200r· min -1 , after culturing for 2h, add 0.1mmol·L -1 IPTG induces the expression of λ-RED protein, grows at 30°C until OD600=0.6, and other steps are the same as before. Take 50 μL of prepared competent cells containing pCas-Red plasmid, add LT donar, transfer to the electroporation cuvette, mix well, and perform electroporation under the same conditions as before. The cells were recovered at 30°C for 2h, spread on LB medium containing Amp, chloramphenicol and 1% glycerol, and cultured at 30°C for 12h. Single clones were picked, and the insertion of the LTh donar gene was verified by PCR using the primers LT donor-F and LT donor-R in Table 1.

Embodiment 3

[0056] Example 3 Screening of LT gene knockout strains

[0057]The correct clone that had been inserted into the LT donar gene was inoculated in a medium containing Amp, IPTG (final concentration 0.1 mmol·L -1 ) and L-arabinose (final concentration 0.2%) in LB medium to induce CRISPR / Cas9 system and λ-RED protein expression. 30℃, 200r·min -1 , cultured for 6h, spread the cells on LB plates containing Amp, and cultured at 30°C for 12h. (dilute at least 10 -4 times). Clones were identified by PCR with primers LT donor-F / LT donor-R. At 42°C, the pCas-Red plasmid is sensitive to temperature. Escherichia coli may lose the pCas-Red plasmid when the temperature is higher than 37°C. Cultivate and screen the LT gene-positive clones to the logarithmic growth phase, and dilute the culture by at least 10 -4 Double and spread on LB plates without any antibiotics, and incubate at 37°C for 12h. Perform PCR verification with the primers Cas9-F / Cas9-R in Table 1, screen the positive clon...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing Escherichia coli with enterotoxin gene LT knockout, comprising the following steps: 1) Constructing LT gene homologous recombination donor LT donar, the base sequence of LT donar includes L-arm, cat promoter in sequence , CmR, sgCommon, PAM, L-short, R-arm polynucleotide fragments; and 2) prepare competent cells containing pCas-Red plasmid, add step 1) LT donar to transform, and then screen positive clones to obtain Escherichia coli with traceless knockout of the heat-labile enterotoxin gene LT. The present invention combines Crispr / Cas9 with the λ-Red homologous recombination system to successfully knock out the LT gene of enterotoxigenic Escherichia coli K88, and the mutant strain loses hemolytic ability and slows down growth; , Convenient and seamless knockout of enterotoxigenic Escherichia coli K88 gene, which provides a solid research basis for the study of LT function.

Description

technical field [0001] The invention relates to the technical field of gene knockout, in particular to an enterotoxin gene LT knockout Escherichia coli and a construction method thereof. Background technique [0002] Enterotoxin is a toxic protein secreted by ETEC. There are two common types: heat-labiletoxin (LT) and heat-stable enterotoxin (ST), which are the main factors leading to diarrhea. . Due to the extremely high morbidity and mortality of pigs infected with Enterotoxigenic Escherichia coli (ETEC), especially in post-weaning piglets, it has brought huge losses to the breeding industry. LT is sensitive to heat, and it can be inactivated by heating at a temperature above 65°C for 30 minutes. However, LT is highly immunogenic and increases the adhesion of enterotoxigenic E. coli and other pathogens to the intestinal epithelium and is therefore highly toxic [1] . The LT of enterotoxigenic Escherichia coli has two subunits, A subunit and B subunit, each subunit is in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/70C12N15/90C12N15/31C12R1/19
CPCC07K14/245C12N15/70C12N15/902
Inventor 邓盾马现永吕晓慧檀克勤
Owner ANIMAL SCI RES INST GUANGDONG ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com