Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of amino acid dehydrogenase and its application

A technology of amino acid dehydrogenase and amino acid, applied in the direction of enzymes, oxidoreductases, biochemical equipment and methods, etc., can solve the problems of complex reaction process, serious environmental pollution, harsh reaction conditions, etc., and achieve simple equipment and high optical purity , the effect of convenient operation

Active Publication Date: 2021-07-09
XIAMEN UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many shortcomings in the chemical synthesis method, the reaction process is complicated; the reaction conditions are harsh; the production cost is high; the environmental pollution is serious, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of amino acid dehydrogenase and its application
  • A kind of amino acid dehydrogenase and its application
  • A kind of amino acid dehydrogenase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] To construct an amino acid dehydrogenase mutant with a single point mutation (G60S), and to mutate the 60th amino acid, the specific steps are as follows:

[0029] (1) Introduce mutations: design primers according to the nucleotides shown in SEQ ID NO.02, and design forward and reverse primers containing different sites. The forward and reverse primers are as follows:

[0030] Upstream primer (SEQ ID NO.05): G60S-F GTGCTGAGATTGTCAAAATCAATG

[0031] Downstream primer (SEQ ID NO.06): G60S-R TGATTTTGACAATCTCAGCACATC

[0032] After mixing the primers and the template plasmid, add high-fidelity Taq polymerase KOD-Plus to carry out PCR amplification of the whole plasmid, and electrophoresis to detect the PCR product after PCR, as figure 1 shown.

[0033] (2) Preparation of crude enzyme solution: construct a recombinant expression strain capable of expressing phenylalanine dehydrogenase with a His-tag tag: the original sequence of the phenylalanine dehydrogenase (PheDH) gene...

Embodiment 2

[0039] Construct an amino acid dehydrogenase mutant with a single point mutation (K76S), and mutate the 76th amino acid. The specific steps are as follows:

[0040] (1) Introduce mutations: design primers according to the nucleotides shown in SEQ ID NO.02, and design forward and reverse primers containing different sites. The forward and reverse primers are as follows:

[0041] Upstream primer (SEQ ID NO.9): K76S-F CTTCGGTGGAGGTTCATCGGTCAT

[0042] Downstream primer (SEQ ID NO.10): K76S-R GAACCTCCACCGAAGTCAACATCT

[0043] After mixing the primers and the template plasmid, add high-fidelity Taq polymerase KOD-Plus to carry out PCR amplification of the whole plasmid, and electrophoresis to detect the PCR product after PCR, as figure 1 shown.

[0044] Experimental steps (2)-(3) are the same as steps (2)-(3) in Example 1.

[0045] (4) Enzyme activity detection: the catalytic reaction system contains 100mM NADH, 0.4mol / L glycine-sodium hydroxide buffer solution (pH 10.5), co-sol...

Embodiment 3

[0048] Construct an amino acid dehydrogenase mutant with a single point mutation (M333D), and mutate the 333-position amino acid. The specific steps are as follows:

[0049] (1) Introduce mutations: design primers according to the nucleotides shown in SEQ ID NO.02, and design forward and reverse primers containing different sites. The forward and reverse primers are as follows:

[0050] Upstream primer (SEQ ID NO.17): M333D-FCAGATATCTACGGATGAAGCAGCA

[0051] Downstream primer (SEQ ID NO.18): M333D-R ATCCGTAGATATCTGGTTCTTTGT

[0052] After mixing the primers and the template plasmid, high-fidelity Taq polymerase KOD-Plus was added to perform PCR amplification of the whole plasmid, and the PCR product was detected by electrophoresis after PCR.

[0053] Experimental steps (2)-(3) are the same as steps (2)-(3) in Example 1.

[0054] (4) Enzyme activity detection: the catalytic reaction system contains 20mM NADH, 0.2mol / L glycine-sodium hydroxide buffer solution (pH 8.0), and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an amino acid dehydrogenase and its application, which is obtained by mutating the amino acid dehydrogenase shown in SEQ ID NO.01. The mutation includes at least one of the following: mutating L at position 57 to E , G at position 60 is mutated to S or T, K at position 76 is mutated to S, Y at position 285 is mutated to L or M, N at position 288 is mutated to E and M at position 333 Mutation to D or R. The present invention remodels the substrate binding pocket through the molecular transformation of the phenylalanine dehydrogenase obtained from the marine strain Bacillus nanhaiensis, which can not only accommodate these large steric substrates, but also bring the substrate and The distance between the coenzymes enables it to obtain catalytic activity for large steric hindrance substrates, and expands its catalytic function for the biosynthesis of a series of unnatural amino acids with large steric hindrance hydrophobic side chains.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an amino acid dehydrogenase and its application. Background technique [0002] Chiral amino acids, including natural amino acids and unnatural amino acids, are key intermediates for the synthesis of fine chemicals such as chiral drugs, chiral pesticides and chiral food additives. For example, D-phenylglycine is an important intermediate of β-lactam semi-synthetic antibiotics, and as an important side chain of ampicillin and ampicillin, the market prospect is broad. Homophenylalanine (L-Homophenylalanine), that is, (S)-2-amino-4-phenylbutyric acid is a non-natural chiral α-amino acid, which is one of the 20 antihypertensive drugs that have been listed in the world Drugs Angiotensin inhibitors Pril-like drugs, such as benazepril, cilazapril, larazapril, enalapril, denazepril, and captopril, are used to treat hypertension and various cardiovascular diseases....

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/06C12P13/04
CPCC12N9/0018C12P13/04C12Y104/0102
Inventor 王世珍刘凯泷韩雨珑
Owner XIAMEN UNIV