Unlock instant, AI-driven research and patent intelligence for your innovation.

Amino acid dehydrogenase and application thereof

An amino acid dehydrogenase, dehydrogenase technology, applied in the directions of enzymes, oxidoreductases, enzymes, etc., can solve the problems of serious environmental pollution, complex reaction process, harsh reaction conditions, etc., and achieve high optical purity, simple equipment, and operation. handy effect

Active Publication Date: 2019-12-24
XIAMEN UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many shortcomings in the chemical synthesis method, the reaction process is complicated; the reaction conditions are harsh; the production cost is high; the environmental pollution is serious, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Amino acid dehydrogenase and application thereof
  • Amino acid dehydrogenase and application thereof
  • Amino acid dehydrogenase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] To construct a single-point mutation (G60S) amino acid dehydrogenase mutant, to mutate the 60 amino acid, the specific steps are as follows:

[0029] (1) Introducing mutations: Design primers based on the nucleotides shown in SEQ ID NO. 02, and design forward and reverse primers containing different positions. The forward and reverse primers are as follows:

[0030] Upstream primer (SEQ ID NO.05): G60S-F GTGCTGAGATTGTCAAAATCAATG

[0031] Downstream primer (SEQ ID NO.06): G60S-R TGATTTTGACAATCTCAGCACATC

[0032] After mixing the primers and the template plasmid, add high-fidelity Taq polymerase KOD-Plus to perform PCR amplification of the whole plasmid. After PCR, the PCR products are detected by electrophoresis, such as figure 1 Shown.

[0033] (2) Preparation of crude enzyme solution: construct a recombinant expression strain capable of expressing phenylalanine dehydrogenase with His-tag tag: the original sequence of phenylalanine dehydrogenase (PheDH) gene is from Bacillus nanh...

Embodiment 2

[0039] To construct a single point mutation (K76S) amino acid dehydrogenase mutant, to mutate the 76 amino acid, the specific steps are as follows:

[0040] (1) Introducing mutations: Design primers based on the nucleotides shown in SEQ ID NO. 02, and design forward and reverse primers containing different positions. The forward and reverse primers are as follows:

[0041] Upstream primer (SEQ ID NO.9): K76S-F CTTCGGTGGAGGTTCATCGGTCAT

[0042] Downstream primer (SEQ ID NO.10): K76S-R GAACCTCCACCGAAGTCAACATCT

[0043] After mixing the primers and the template plasmid, add high-fidelity Taq polymerase KOD-Plus to perform PCR amplification of the whole plasmid. After PCR, the PCR products are detected by electrophoresis, such as figure 1 Shown.

[0044] The experimental steps (2)-(3) are the same as the steps (2)-(3) of Example 1.

[0045] (4) Enzyme activity detection: The catalytic reaction system contains 100mM NADH, 0.4mol / L glycine-sodium hydroxide buffer solution (pH 10.5), the co-sol...

Embodiment 3

[0048] To construct a single-point mutation (M333D) amino acid dehydrogenase mutant, to mutate amino acid 333, the specific steps are as follows:

[0049] (1) Introducing mutations: Design primers based on the nucleotides shown in SEQ ID NO. 02, and design forward and reverse primers containing different positions. The forward and reverse primers are as follows:

[0050] Upstream primer (SEQ ID NO.17): M333D-FCAGATATCTACGGATGAAGCAGCA

[0051] Downstream primer (SEQ ID NO.18): M333D-R ATCCGTAGATATCTGGTTCTTTGT

[0052] After mixing the primers and the template plasmid, the high-fidelity Taq polymerase KOD-Plus is added to perform PCR amplification of the whole plasmid. After PCR, the PCR products are detected by electrophoresis.

[0053] The experimental steps (2)-(3) are the same as the steps (2)-(3) of Example 1.

[0054] (4) Enzyme activity detection: The catalytic reaction system contains 20mM NADH, 0.2mol / L glycine-sodium hydroxide buffer solution (pH 8.0), the co-solvent is 15% Tween...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses amino acid dehydrogenase and application thereof. The amino acid dehydrogenase is obtained by mutating amino acid dehydrogenase shown as SEQ ID NO.01, mutation includes at least one of the following: L at the 57 bit is mutated into E, G at the 60 bit is mutated into S or T, K at the 76 bit is mutated into S, Y at the 285 bit is mutated into L or M, N at the288 bit is mutated into E, and M at the 333<rd> bit is mutated into D or R. By modifying molecules of phenylalanine dehydrogenase obtained from a marine strain, namely bacillus nanhaiensis, a substrate binding pocket of the phenylalanine dehydrogenase is remodeled, large steric hindrance substrates can be accommodated, meanwhile, the substrates are brought closer to coenzyme, thus the amino acid dehydrogenase obtains catalytic activity to the large steric hindrance substrates, and the catalytic function of the amino acid dehydrogenase is expanded for the biosynthetic series of non-naturalamino acids with large steric hindrance hydrophobic side chains.

Description

Technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an amino acid dehydrogenase and its application. Background technique [0002] Chiral amino acids, including natural amino acids and unnatural amino acids, are key intermediates for the synthesis of fine chemicals such as chiral drugs, chiral pesticides and chiral food additives. For example, D-phenylglycine is an important intermediate of β-lactam semi-synthetic antibiotics. As an important side chain of ampicillin and pivampicin, it has a broad market prospect. L-Homophenylalanine, namely (S)-2-amino-4-phenylbutyric acid is an unnatural chiral α-amino acid, which is one of 20 antihypertensives that have been marketed worldwide Drugs Angiotensin inhibitor Pristine drugs, such as benazepril, cilazapril, lisiropril, enalapril, dinapril and captopril, etc. are used to treat hypertension and various cardiovascular diseases The common chiral intermediate in the sy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/06C12P13/04
CPCC12N9/0018C12P13/04C12Y104/0102
Inventor 王世珍刘凯泷韩雨珑
Owner XIAMEN UNIV