Method for detecting CYP21A2 gene mutation, primer and kit

A CYP21A2 and reagent kit technology, applied in the fields of life science and biology, can solve the problems of cumbersome, time-consuming and labor-intensive, and difficult to carry out widely, and achieve the effects of simplifying operation steps, saving detection costs, and reducing detection costs

Pending Publication Date: 2020-04-03
FUZHOU ADICON CLINICAL LAB INC
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This high degree of homology makes it difficult to detect CYP21A2 mutations. Therefore, qPCR technology cannot be applied to the detection of complex rearrangements, and it is difficult to carry out extensive research.
Other techniques such as Southern hybridization, allele-specific polymerase chain reaction, allele-specific oligonucleotide probes, RFLP, etc. are cumbersome, time-consuming, or unable to detect all mutation types, etc., and cannot be used These methods detect mutations in the gene CYP21A2

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting CYP21A2 gene mutation, primer and kit
  • Method for detecting CYP21A2 gene mutation, primer and kit
  • Method for detecting CYP21A2 gene mutation, primer and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Kits for detection of gene CYP21A2 mutation sites, including: tissue DNA extraction kit (for example, using Tiangen Bio’s DNA extraction kit); absolute ethanol; amplification system PCR reaction solution, sequencing system reaction solution, positive control , negative control substance and blank control substance, wherein

[0057] The amplification system PCR reaction solution includes: 2×PCR Buffer; 2mMdNTPs; KOD FX DNA Polymerase (1U / μl); at least one pair of amplification primers are used to amplify the gene CYP21A2, and the amplification primers are selected from CYP21A2-1_2F / CYP21A2-1_2R , CYP21A2-3_6F / CYP21A2-3_6R, CYP21A2-7_9F / CYP21A2-7_9R, CYP21A2-10F / CYP21A2-10R, the base sequence of which is:

[0058] CYP21A2-1_2F: TGATGTGGAACCAGAAAGCTGTAAAACGACGGCCAGT

[0059] CYP21A2-1_2R: GGGCAGCATAGCAAAGAACAACAGCTATGACCATG;

[0060] CYP21A2-3_6F: TCCCACCTCAGCCTCAAGTTGTAAAACGACGGCCAGT

[0061] CYP21A2-3_6R: ACCCGCCTCATAGCAATGAACAGCTATGACCATG;

[0062] CYP21A2-7_9F: ACA...

Embodiment 2

[0075] Example 2 Blood sample DNA detection process

[0076] (1) Genomic DNA extraction from blood:

[0077] 1) Take 500uL of blood and add 1000uL red blood cell lysate, mix it upside down, place it at room temperature for 5 minutes, and then mix it upside down several times during the period, then centrifuge at 3000rpm for 5min, absorb the supernatant, leave the white blood cell precipitate, add 200uL buffer GA, shake until thoroughly mixed;

[0078] 2) Add 20 μl proteinase K solution and mix well;

[0079] 3) Add 200 μl buffer GB, mix thoroughly by inversion, place at 70°C for 10 minutes, the solution should become clear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0080] 4) Add 200 μl of absolute ethanol, shake and mix well for 15 seconds. At this time, flocculent sediment may appear, and briefly centrifuge to remove water droplets on the inner wall of the tube cap;

[0081] 5) Add the solution and flocculent precipitate obtained ...

Embodiment 3

[0115] Three clinical whole blood samples were taken, and the whole exon mutation of CYP21A2 gene related to congenital adrenal hyperplasia was detected in each sample. The genome was extracted, reagents were prepared and tested according to the method described in Example 2. For each sample, 2 μl of the extracted genomic DNA was added to the PCR reaction solution of the amplification system, and positive, negative, and blank control experiments were performed at the same time. A 96-well ordinary PCR machine can detect 46 samples at the same time, each sample has 2 repetitions, a positive control, a negative control and a blank control. The detection time is 160 minutes.

[0116] In addition, the sequencing results of sample 1 are as follows Figure 1-4 All shown are wild type. The sequencing results of samples 2 and 3 were also wild type.

[0117] It can be seen from the detection results that the primers of the present invention have included all the exons of the CYP21A2...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting CYP21A2 gene mutation related to congenital adrenal hyperplasia, a primer and a kit. The primer and the kit respectively comprise an amplification primerand a sequencing primer aiming at all exons of a CYP21A2 gene. Based on PCR amplification and Sanger sequencing, the mutation condition of the mutation site of the CYP21A2 gene related to the congenital adrenal hyperplasia can be quickly detected.

Description

technical field [0001] The invention belongs to the field of life science and biotechnology, and in particular relates to a method, primer and kit for detecting CYP21A2 gene mutation related to congenital adrenal hyperplasia. Background technique [0002] Congenital adrenal hyperplasia (CAH) is a group of autosomal recessive genetic diseases caused by defects in the enzymes involved in the synthesis of adrenocortical hormones. According to enzyme deficiency, Chengdu CAH can be divided into salt-losing CAH, simple virilizing CAH, and atypical CAH. The former two are collectively referred to as typical CAH. The incidence of the disease is low, the incidence of neonatal CAH is about 1 / 16000~1 / 20000, the incidence of typical CAH is about 1 / 10000, the incidence of atypical CAH is about 10 times of the typical, and female more than men. 21 hydroxylase deficiency (21OHD) is the most common type, accounting for about 90%-95%, and the incidence of 21OHD in newborns is about 1 / 15000...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6883C12Q1/6869C12N15/11
CPCC12Q1/6883C12Q1/6869C12Q2600/156C12Q2531/113C12Q2535/101
Inventor柏忠良
OwnerFUZHOU ADICON CLINICAL LAB INC