Bifidobacterium lactis BL-99 capable of regulating gastrointestinal florae and application of Bifidobacterium lactis BL-99
A technology of bifidobacterium lactis and live bacteria, applied in the field of microorganisms, can solve problems such as human health risks, achieve the effect of no antibiotic tolerance, wide application prospects, and growth promotion
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Embodiment 1: Bifidobacterium lactis BL-99 and performance measurement thereof
[0036] The Bifidobacterium lactis BL-99 of the present invention is from Shanghai Jiaoda Only Co., Ltd., and is isolated from the intestinal tract of infants. The strain was preserved in China General Microorganism Culture Collection and Management Center CGMCC on April 26, 2018 (Address: No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences), taxonomic name: Bifidus lactis Bacillus (Bifidobacterium lactis); the deposit number is CGMCC No.15650.
[0037] 1. Taxonomic characteristics of Bifidobacterium lactis BL-99
[0038] Physical and chemical test results:
[0039]
[0040] 16S rRNA gene sequence sequencing results (SEQ ID No.1):
[0041] GCTCCCCCACAAGGGTCGGGCCACCGGCTTCGGGTGCTACCCACTTTCATGACTTGACGGGCGGTGTGTACAAGGCCCGGGAACGCATTCACCGCGGCGTTGCTGATCCGCGATTACTAGCGACTCCGCCTTCACGCAGTCGAGTTGCAGACTGCGATCCGAACTGAGACCGGTTTTCAGC...
Embodiment 2
[0055] Example 2: Analysis of the regulation effect of active Bifidobacterium lactis intestinal flora
[0056] This example intends to prove the effect of the Bifidobacterium lactis of the present invention on intestinal regulation. For the principle and steps, please refer to "Technical Specifications for Inspection and Evaluation of Health Food - Judgment Criteria for Regulating the Function of Intestinal Flora".
[0057] After culturing Bifidobacterium lactis BL-99 strain in MRS liquid medium at 37°C for 16 hours, centrifuge at 4°C and 2500rpm for 10 minutes to collect the bacteria, wash with phosphate buffer saline (PBS) and freeze-dry to obtain the bacterial powder Store below -18°C. Used in various experimental studies of this embodiment.
[0058] Take 36 healthy SPF grade BABL / c mice weighing 18-22 g (provided by Beijing Huafukang Biotechnology Co., Ltd.). After 3 days of adaptive feeding, they were randomly divided into 3 groups, 12 in each group, namely blank contro...
Embodiment 3
[0079] Example 3: Comparison of intestinal flora regulation effects of different doses of active Bifidobacterium lactis and inactivated strains
[0080] In this example, the intestinal flora regulation effects of different doses of active Bifidobacterium lactis BL-99 and inactivated strains were tested.
[0081] Viable bacteria sample: According to the sample specification, weigh 1g of viable bacterial sample and suspend it to 40ml with PBS solution, that is, the concentration of viable bacteria is 2.5x10 9 CFU / ml.
[0082] High-dose group: calculated according to the amount of 0.2ml / 10g intragastric administration of mice, the intragastric administration amount of 20g mice is 0.4ml, and the intragastric administration dose of mice in high-dose group is 10 9 CFU / 20g.
[0083] Medium-dose group: Take 5ml of high-dose suspension and add PBS to make up to 50ml respectively. According to the calculation of 0.2ml / 10g gavage volume of mice, the gavage volume of 20g mice is 0.4ml, ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



