Method for quantitatively detecting kappa-carrageenan by enzymic method

A quantitative detection and carrageenan technology, applied in the field of biotechnology and biochemical detection, can solve the problems of time-consuming, laborious, poor reproducibility, and complicated operation.

Active Publication Date: 2020-05-05
OCEAN UNIV OF CHINA
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] The technical problem to be solved in the present invention is that the commonly used quantitative detection methods for κ-carrageenan are phenol-sulfuric acid method and liquid chromatography-tandem mass spectrometry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quantitatively detecting kappa-carrageenan by enzymic method
  • Method for quantitatively detecting kappa-carrageenan by enzymic method
  • Method for quantitatively detecting kappa-carrageenan by enzymic method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Cloning, expression and acquisition of κ-carrageenase Cgk1_Wa in Escherichia coli

[0034] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm and the whole genome DNA was extracted. The upstream and downstream primers (5'- GACACGGATCCACTTCTCAAAATTTAAGACCGCTTAATGC; 5'- GACACCTCGAGTTAATCTATAATTATTTTTTGGGTTTTAATTCC) were designed according to the target gene, and PCR was carried out using the whole genome as a template. The PCR reaction conditions were: : 95°C for 3 minutes, 94°C for 30s, 58°C for 30s, 72°C for 150s, 22 cycles, and finally 72°C for 5 minutes to obtain the κ-carrageenase Cgk1_Wa gene fragment, which was connected to the DH5α vector to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. The expression was induced by isopropylthiogalactoside in LB medium containing kanamycin, the induction temperature was 17°C, and the induction tim...

Embodiment 2

[0036] Example 2: Cloning, expression and acquisition of κ-carrageenase Cgk1_Wa in Bacillus subtilis

[0037]Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm and the whole genome DNA was extracted. The upstream and downstream primers (5'-GTACACGGATCCACTTCTCAAAATTTAAGACCGCTT; 5'-TTAGCTCGAGTTAATCTATAATTATTTTTTGGGTTTACCG) were designed according to the target gene, and the whole genome was used as a template for PCR as in Example 1. The κ-carrageenase Cgk1_Wa gene fragment was obtained and connected to the pHT01 vector to form a recombinant plasmid. The recombinant plasmid was transformed into competent cells of Bacillus subtilis, positive clones were screened and expressed in LB culture medium with isopropylthiogalactoside, the induction temperature was 38°C, and the induction time was 14h. Collect the cells by centrifugation, add a certain amount of 20mM Na 2 HPO 4 -NaH 2 PO 4 Suspend in the buffer, and then perform ultrasonic crus...

Embodiment 3

[0038] Example 3: Cloning, expression and acquisition of κ-carrageenase Cgk1_Wa in Pichia pastoris

[0039] Wenyingzhuangia aestuarii OF219 was cultured in 2216E medium until the end of the logarithm, and the whole genome DNA was extracted, and the upstream and downstream primers (5'- GGAATGGATCCACTTCTCCAAAATTTAAGACCGCTTAA; 5'-CCGTATCGAGTTAATCTATAATTATTTTTTGGGTTTTAGGCC) were designed according to the target gene, and the whole genome was used as a template for PCR as in Example 1. The κ-carrageenase Cgk1_Wa gene fragment was obtained, connected to the pPIC9k vector to form a recombinant plasmid, and added to Pichia pastoris GS115 competent cells to form a recombinant cell; positive clones were screened and inoculated in YPD medium, cultured at 30°C for 20 hours, and then Inoculate in BMGY medium, culture on a shaker at 30°C and 200rpm until OD600=2.0, collect the bacteria by centrifugation, discard the supernatant, resuspend the pellet in BMMY medium, induce culture with methan...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, in particular to a method for quantitatively detecting kappa-carrageenan by an enzymic method. The method comprises the following steps: specifically hydrolyzing the kappa-carrageenan into reducing sugar by utilizing kappa-carrageenase; after enzyme inactivation, adding a p-hydroxybenzohydrazide solution for achromogenic reaction; after centrifugation, measuring a light absorption value of supernate at the position of 400-420 nm; and the comparing the light absorption value to a standard curve to obtain the content of the kappa-carrageenan. The detection method is good in linear range and high in accuracy, and can be popularized and used in the markets.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to a method for quantitatively detecting κ-carrageenan by enzymatic method. Background technique [0002] Carrageenan (carrageenan), also known as carrageenan or carrageenan, is a natural anionic sulfate linear polysaccharide extracted from the cell walls of red algae such as carrageen, Eucheuma, and firella. According to the sulfate group on galactose in the structure There are many types of carrageenans depending on the number and linking position and the content of 3,6-anhydrogalactose. κ-carrageenan is one of three common types of carrageenan (κ-, ι- and λ-carrageenan), which consist of alternating sulfated-α-D-3,6-anhydrogalactose and sulfated-β- Composed of D-galactose residues, due to its wide range of sources and diverse functions, it is used in many industrial productions such as food, medicine, cosmetics, etc., as a coagulant, binder, stab...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/44C12N9/38C12N15/56G01N21/31
CPCC12Q1/44C12N9/2468G01N21/31C12Y302/01083
Inventor 常耀光申晶晶薛长湖陈广宁张玉莹李嘉靖薛勇唐庆娟
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap