Electrochemical detection method of cocaine based on rolling circle amplification and supramolecular aptamer

A rolling circle amplification, cocaine technology, applied in the direction of material electrochemical variables, can solve the problems of large quantitative analysis error, large standard deviation, low detection sensitivity, etc., to improve sensitivity and specificity, improve sensitivity and linear range, The effect of reducing the blank signal

Inactive Publication Date: 2014-03-12
CHONGQING MEDICAL UNIVERSITY
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The method for the color detection of cocaine using an unmodified three-stage aptamer probe and the method for electrochemically detecting cocaine using one or two-stage aptamers have the following disadvantages: they have very large limitations, and the detection sensitivity Not high (0.5μM~10μM level), large standard deviation, large quantitative analysis error

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Electrochemical detection method of cocaine based on rolling circle amplification and supramolecular aptamer
  • Electrochemical detection method of cocaine based on rolling circle amplification and supramolecular aptamer
  • Electrochemical detection method of cocaine based on rolling circle amplification and supramolecular aptamer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Embodiment 1. Preparation of circularized DNA

[0037] Mix 100 nM template DNA phosphorylated at the 5' end to be circularized and 100 nM biotin-modified primer DNA in 100 μL buffer containing 6.6 mM magnesium chloride, 10 mM dithiothreitol, 1 mM ATP, 66 mM Tris, pH 7.6, and then Add 0.2 U of T4 DNA ligase, perform ligation reaction at 37°C for 60 minutes, inactivate T4 DNA ligase at 65°C for 10 minutes, and store the obtained circularized DNA at -20°C for future use. The DNA sequence of the template to be circularized is:

[0038] 5'-P-TATGCCCAGCCCTGTAAGATGAAGATAGCGCAGAATGGTCGGATTCTCAACTCGTATCTGCCCTGACTTC, the primer DNA sequence is: 5'-Biotin-AAAAAAAAAAAACAGGGCTGGGCATAGAAGTCAGGGCAGA.

Embodiment 2

[0039] Embodiment 2, the method for the electrochemical detection of cocaine based on rolling circle amplification and supramolecular aptamers is carried out according to the following steps:

[0040] 1) The bare gold electrode is polished with 0.05 μm alumina powder, ultrasonically washed in water, and immersed in piranha solution (concentrated H 2 SO 4 :H 2 o 2 The volume ratio is 3:1) for 10 to 15 minutes, wash the gold electrode with deionized water, and dry it naturally at room temperature;

[0041] 2) Add 50 nM sulfhydryl-labeled aptamer fragment Co3S prepared in 10 μL of TE buffer solution (pH 8.0, 10 mMTris, 1 mMEDTA) dropwise onto the gold electrode in step 1, and place in a 4°C refrigerator overnight; the sulfhydryl-labeled The Co3S sequence of the aptamer fragment is:

[0042] 5’-GGGAGTCAAGAACGAAAAAAAA-thiol-(CH 2 ) 3 ;

[0043] 3) Rinse the gold electrode in step 2 with washing buffer, block with 10 μL of 1 mM 6-mercapto-1-hexanol for 1 to 1.5 h, wash the go...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle sizeaaaaaaaaaa
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses an electrochemical detection method of cocaine based on rolling circle amplification and a supramolecular aptamer. The method comprises the steps of dropwise adding an aptamer segment Co3S onto a cleaned gold electrode, taking out for sealing after overnighting in a refrigerator, dropwise adding an aptamer segment Co3B and a sample to be detected on the gold electrode, after reaction at 37 DEG C, dropwise adding a streptavidin solution for incubation, then adding a cyclized DNA (deoxyribonucleic acid) solution for incubation, performing rolling circle amplification, adding a detection probe for hybridization and performing DPV (differential pulse voltammetry) signal detection. The method utilizes the rolling circle amplification and the supramolecular aptamer for electrochemical detection of the cocaine for the first time, greatly improves sensitivity and specificity of cocaine detection, and allows a linear detection range to reach 10-500nM. The streptavidin solution and cyclized DNA in the same volume and at the same concentration are utilized, an identification element and an amplifier element are separated, a blank signal is decreased by a bridge connection effect of streptavidin is only utilized, and the sensitivity and the linear range of the detection are greatly improved and extended.

Description

technical field [0001] The invention relates to a method for detecting cocaine, in particular to a method for electrochemically detecting cocaine based on rolling circle amplification and supramolecular aptamers, and belongs to the field of biological detection. Background technique [0002] Cocaine (cocaine) is the main alkaloid contained in coca leaves, also known as cocaine. There are many alkaloids in coca leaves, mainly cocaine, ecgonine, benzoylecgonine, cocaine cinnamate and cocaine N-formaldehyde, which have serious toxic effects on the central nervous system. Currently, methods for cocaine detection include gas chromatography (GC), high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), thin-layer chromatography (TLC), electronic nose, electron capture, and imaging. Micro Raman technology (MRS, micro raman spectroscopy), X-ray detection technology and thermal neutron tomography, etc. The detection sensitivity of these technolog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): G01N27/48
Inventor丁世家李剑波汤华唐仁宽李永国颜玉蓉申波朱丹雷品华张伟刘刚李佳迅
OwnerCHONGQING MEDICAL UNIVERSITY