Gene encoding Milletanum chalcone synthase and its application
What is Al technical title?
Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A technology of chalcone synthase and chalcone synthase, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve the problems of near-depletion of wild resources and no discovery of chalcone synthase cloning of chalcone vine.
Active Publication Date: 2021-09-10
GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF2 Cites 0 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
At present, the medicinal materials of Caulis Spatholobus in the market are mainly derived from wild resources. Due to years of harvesting, China's wild resources are on the verge of depletion.
However, the cloning of the Milletanus chalcone synthase (SsCHS) gene and its application as a method for increasing the content of flavonoids in plants have not yet been found.
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0032] SsCHS Gene Cloning
[0033] (1) RNA and DNA extraction: Trizol reagent (Invitrogen, USA) was used to extract total RNA from fresh young leaves of Mildew Spatholobus, and pretreated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel, and RNA purity and concentration were determined spectrophotometrically.
[0034] The total DNA was extracted from the young leaves of Mildew Spatholobus by plant DNA kit (TIANGEN).
[0035] (2) Gene cloning: design primers according to the CHS sequence in the Genome of Spatholobus Spatholobus, use DNA as a template, and use Primer5.0 software to design gene-specific primers:
[0036] F1: CCCGTCCCTCATACCTACTCGCGC (SEQ ID NO: 4)
[0037] R1: AAGACATTCTCCTGCAACAC (SEQ ID NO: 5)
[0038] Through PCR amplification, a gDNA sequence with a length of 2025bp was obtained, such as SEQ ID NO:1.
Embodiment 2
[0040] SsCHS Gene Cloning
[0041] The RNA extracted in Example 1 was reverse-transcribed (AMV first strand cDNA synthesis kit: Roche, Switzerland), using the first strand cDNA as a template, using primers
[0042] F1: ATGGTGACCGTGGAGGAAATCCG (SEQ ID NO: 6)
[0043] R1: CCTTGGACCTCTTTCCTCACC (SEQ ID NO: 7)
[0044] Through PCR amplification, a cDNA sequence SEQ ID NO: 2 with a length of 1063 bp was obtained.
Embodiment 3
[0046] After translation of the cDNA sequence according to Example 2, the amino acid sequence SEQ ID NO: 3 coding for Milletera chalcone synthase (SsCHS) was obtained.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a gene encoding Milletera chalcone synthase and its application. The gene is first obtained from Millipeda spatula and fills the chalcone synthase gene isolated and cloned from the traditional Chinese medicinal material Millet Spatholobus. Whitespace. The chalcone synthase gene provided by the present invention has the nucleotide sequence shown in SEQ ID NO.1 or a homologous sequence with addition, substitution, insertion or deletion of one or more nucleotides or its allele and its Derived Nucleotide Sequence. The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO.3 or a homologous sequence with addition, substitution, insertion or deletion of one or more amino acids. The gene is expressed in the roots, stems, leaves, flowers and fruits of Mildew Spathifolia, and the expression level is higher in leaves and flowers. The application of the chalcone synthase gene provided by the invention and the improvement of the content of active components of flavonoids in Spathifolia have good application prospects for improving germplasm resources of Spathifolia in the future.
Description
technical field [0001] The present invention relates to the field of biotechnology, and relates to key enzymes and genes encoding them in the synthetic pathway of gallinaceae flavonoids. More specifically, the present invention relates to genes encoding Milletera chalcone synthase and applications thereof. Background technique [0002] Spatholobus Spatholobus is derived from the dried cane of Spatholobus suberectus Dunn, a plant of the family Leguminosae. It is a commonly used traditional Chinese medicine with a bitter, sweet, warm nature and returns to the liver and kidney meridians. It has the effects of nourishing blood and promoting blood circulation, regulating menstruation and relieving pain, relaxing tendons and activating collaterals. It is used to treat irregular menstruation, dysmenorrhea, amenorrhea, rheumatic arthralgia, numbness and paralysis, blood deficiency and chlorosis, etc. It is widely used in Chinese patent medicines such as gynecology and rheumatic arth...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more