Unlock instant, AI-driven research and patent intelligence for your innovation.

The gene encoding the anthocyanin reductase of S. chinensis and its application

A technology of wisteria anthocyanin and reductase, which is applied to the gene encoding spaghetti anthocyanin reductase and its application field, can solve the problems of undiscovered research and reports, and achieve the effect of high application value

Active Publication Date: 2021-10-12
GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ANR gene of Spatholobus has not been cloned yet, and no research or report on its application as an increase in plant epicatechin content has been found.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • The gene encoding the anthocyanin reductase of S. chinensis and its application
  • The gene encoding the anthocyanin reductase of S. chinensis and its application
  • The gene encoding the anthocyanin reductase of S. chinensis and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] SsANR Gene Cloning

[0031] (1) RNA and DNA extraction: Trizol reagent (Invitrogen, USA) was used to extract total RNA from fresh young leaves of Mildew Spatholobus, and pretreated with RNase Free DNase (Promega, USA) to eliminate genomic DNA contamination. RNA integrity was analyzed on a 1.5% agarose gel, and RNA purity and concentration were determined spectrophotometrically.

[0032] The total DNA was extracted from the young leaves of Mildew Spatholobus by plant DNA kit (TIANGEN).

[0033] (2) Gene cloning: design primers according to the ANR sequence in the Genome of Spatholobus Spatholobus, use DNA as a template, and use Primer5.0 software to design gene-specific primers

[0034] F1: CGGATTTATGGCCTCTTG (SEQ ID NO: 4)

[0035] R1: TGACTTGATTCTCGCACC (SEQ ID NO: 5)

[0036] Through PCR amplification, a gDNA sequence with a length of 1996 bp was obtained, such as SEQ ID NO:1.

Embodiment 2

[0038] SsANR Gene Cloning

[0039] The RNA extracted in Example 1 was reverse-transcribed (AMV first strand cDNA synthesis kit: Roche, Switzerland), using the first strand cDNA as a template, using primers:

[0040] F1:TCTTTCCAGCTTGCTACACC (SEQ ID NO: 6)

[0041] R1: CTTTGAGGGACAATCTTCG (SEQ ID NO: 7)

[0042] Through PCR amplification, the cDNA sequence SEQ ID NO: 2 with a length of 644bp was obtained.

Embodiment 3

[0044] According to the translation of the cDNA sequence in Example 2, the amino acid sequence SEQ ID NO: 3 encoding anthocyanidin reductase (SsANR) of S. santiculata was obtained.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene encoding the anthocyanin reductase of spaghetti spaghetti and its application, which fills up the blank of isolating and cloning the anthocyanin reductase gene from the traditional Chinese medicinal material Millipeda spatula. The anthocyanin reductase gene provided by the present invention has the nucleotide sequence shown in SEQ ID NO.1 or a homologous sequence with addition, substitution, insertion or deletion of one or more nucleotides or its allele and its Derived Nucleotide Sequence. The protein encoded by the gene has the amino acid sequence shown in SEQ ID NO.3 or a homologous sequence with addition, substitution, insertion or deletion of one or more amino acids. The gene is expressed in the roots, stems, leaves, flowers and fruits of Miltonia Spatholobus, and the expression level is higher in roots and stems, and the content in leaves is very low. The anthocyanin reductase provided by the invention helps to increase the content of the active ingredient epicatechin in the spatula spatholobus by using the genetic engineering technology, and has good application prospects for improving germplasm resources of the spatula spatula in the future.

Description

technical field [0001] The present invention relates to the field of biotechnology, and relates to key enzymes and genes encoding them in the biosynthetic pathway of epicatechin, an active component of Milletera spatula, more specifically, the present invention relates to genes encoding anthocyanin reductases of Millipeda spatula and its application . Background technique [0002] Spatholobus suberectus Dunn is derived from the dried cane of the leguminous plant Spatholobus suberectus Dunn. It is used to treat irregular menstruation, dysmenorrhea, amenorrhea, rheumatic arthralgia, numbness and paralysis, blood deficiency and chlorosis, etc. It is widely used in Chinese patent medicines such as gynecology and rheumatic arthralgia. The research results show that the main active ingredients of Spatholobus Spatholobus are flavonoids, among which epicatechin is one of the main active ingredients. [0003] In the synthesis pathway of epicatechin, anthocyanidin reductase (ANR) ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/04C12N15/11C12N15/82A01H5/00A01H6/82
CPCC12N9/0006C12N15/8243
Inventor 秦双双欧春丽乔柱梁莹缪剑华
Owner GUANGXI BOTANICAL GARDEN OF MEDICINAL PLANTS