Recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, engineering bacterium and application thereof
A technology of recombinant plasmid and glutathione, applied in the field of fermentation, can solve problems such as single regulation of intracellular ATP level, etc., and achieve the effect of promoting glutathione synthesis, improving synthesis, and improving glutathione product synthesis ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Construction of plasmid pRSFDuet-ydaO-ppk that dynamically regulates intracellular ATP levels
[0040] Genomic DNA was extracted from Bacillus subtilis with a bacterial genome extraction kit purchased from Tiangen Company as a template, and primers Bam H I- yda O-F5'-CGGGATCCGATTTTAGCCTCTG (sequence shown in SEQ ID NO: 4) and Pst I- yda O-R5'-AACTGCAGAATCAAAAAACGTTTGA (sequence shown in SEQ ID NO: 5) is used as a primer to amplify the ydaO fragment, and the gene sequence is shown in SEQ ID NO: 1. Amplification system (100 μl): double distilled water 60.5 μl, dNTP 8 μl (200 μmol / L), buffer 20 μl (Mg2+50 mmol / L), upstream and downstream primers 5 μl (10 umol / L), template 0.5 μl, Phusion High - Fidelity polymerase 1 μl. PCR amplification conditions: after pre-denaturation at 98°C for 30 sec, denaturation at 98°C for 10 s, annealing at 58°C for 20 s, extension at 72°C for 10 sec, 30 cycles. The target fragment was obtained after extension at 72°C for 5...
Embodiment 2
[0041] Example 2: Construction of plasmid pRSFDuet-ydaO-ppk-gshf with bifunctional glutathione synthetase
[0042] Genomic DNA was extracted from Streptococcus thermophilus as a template with a bacterial genome extraction kit purchased from Tiangen Company to Nde I- gshf -F5'-GGAATTCCATATGATGACATTAAACCAACTTCTTCA (sequence shown in SEQ ID NO: 8) and xho I- gshf -R 5'- CCGCTCGAGTTAAGTTTGACCAGCCACTATTTCTG (sequence shown in SEQ ID NO: 9) is a primer to amplify the gshf fragment, and its gene sequence is shown in SEQ ID NO: 3. Amplification system (100 μl): 60.5 μl of double distilled water, 8 μl of dNTP (200 μmol / L), 20 μl of buffer (Mg2+50 mmol / L), 5 μl of upstream and downstream primers (10 μmol / L), 0.5 μl of template, Phusion High- Fidelity polymerase 1 μl. PCR amplification conditions: after pre-denaturation at 98°C for 30 sec, denaturation at 98°C for 10 s, annealing at 65°C for 20 s, extension at 72°C for 1 min, 30 cycles. The target fragment was obtained after e...
Embodiment 3
[0043] Example 3: Experiments to verify the response of the ATP riboswitch ydaO module to the concentration of ATP
[0044] The pRSFDuet-ydaO-gfp (ydaO module downstream connection gfp gene preserved in the laboratory, Image 6 ) plasmid was marked as AYG, and the ATP concentration was changed by adjusting the phosphate concentration in the medium, and the influence of the ATP concentration change on the downstream gene expression of ydaO was verified by the intensity of green fluorescence. And the pRSFDuet-ydaO plasmid strain was used as the control strain ControlY. The two strains were cultured overnight in LB medium (200 rpm, 37° C.) supplemented with appropriate antibiotics. Overnight LB cultures were inoculated at 1% (v / v) into fresh M9 medium for fermentation. When the biomass of the bacteria was 0.4-0.6 at OD600, the cells were induced with different concentrations of the inducer IPTG, and then fermented at 30°C and 200rpm. The experiment was recorded as Normal in th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


