Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, engineering bacterium and application thereof

A technology of recombinant plasmid and glutathione, applied in the field of fermentation, can solve problems such as single regulation of intracellular ATP level, etc., and achieve the effect of promoting glutathione synthesis, improving synthesis, and improving glutathione product synthesis ability

Active Publication Date: 2020-06-12
HENAN UNIV OF SCI & TECH
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to solve the problem of single regulation of intracellular ATP level in the prior art, the first object of the present invention is to provide a recombinant plasmid that promotes glutathione synthesis through dynamic regulation of ATP, the second object is to provide an engineering bacterium, and the third object is to Provides the use of the engineering bacteria to promote the application of glutathione synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, engineering bacterium and application thereof
  • Recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, engineering bacterium and application thereof
  • Recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, engineering bacterium and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of plasmid pRSFDuet-ydaO-ppk that dynamically regulates intracellular ATP levels

[0040] Genomic DNA was extracted from Bacillus subtilis with a bacterial genome extraction kit purchased from Tiangen Company as a template, and primers Bam H I- yda O-F5'-CGGGATCCGATTTTAGCCTCTG (sequence shown in SEQ ID NO: 4) and Pst I- yda O-R5'-AACTGCAGAATCAAAAAACGTTTGA (sequence shown in SEQ ID NO: 5) is used as a primer to amplify the ydaO fragment, and the gene sequence is shown in SEQ ID NO: 1. Amplification system (100 μl): double distilled water 60.5 μl, dNTP 8 μl (200 μmol / L), buffer 20 μl (Mg2+50 mmol / L), upstream and downstream primers 5 μl (10 umol / L), template 0.5 μl, Phusion High - Fidelity polymerase 1 μl. PCR amplification conditions: after pre-denaturation at 98°C for 30 sec, denaturation at 98°C for 10 s, annealing at 58°C for 20 s, extension at 72°C for 10 sec, 30 cycles. The target fragment was obtained after extension at 72°C for 5...

Embodiment 2

[0041] Example 2: Construction of plasmid pRSFDuet-ydaO-ppk-gshf with bifunctional glutathione synthetase

[0042] Genomic DNA was extracted from Streptococcus thermophilus as a template with a bacterial genome extraction kit purchased from Tiangen Company to Nde I- gshf -F5'-GGAATTCCATATGATGACATTAAACCAACTTCTTCA (sequence shown in SEQ ID NO: 8) and xho I- gshf -R 5'- CCGCTCGAGTTAAGTTTGACCAGCCACTATTTCTG (sequence shown in SEQ ID NO: 9) is a primer to amplify the gshf fragment, and its gene sequence is shown in SEQ ID NO: 3. Amplification system (100 μl): 60.5 μl of double distilled water, 8 μl of dNTP (200 μmol / L), 20 μl of buffer (Mg2+50 mmol / L), 5 μl of upstream and downstream primers (10 μmol / L), 0.5 μl of template, Phusion High- Fidelity polymerase 1 μl. PCR amplification conditions: after pre-denaturation at 98°C for 30 sec, denaturation at 98°C for 10 s, annealing at 65°C for 20 s, extension at 72°C for 1 min, 30 cycles. The target fragment was obtained after e...

Embodiment 3

[0043] Example 3: Experiments to verify the response of the ATP riboswitch ydaO module to the concentration of ATP

[0044] The pRSFDuet-ydaO-gfp (ydaO module downstream connection gfp gene preserved in the laboratory, Image 6 ) plasmid was marked as AYG, and the ATP concentration was changed by adjusting the phosphate concentration in the medium, and the influence of the ATP concentration change on the downstream gene expression of ydaO was verified by the intensity of green fluorescence. And the pRSFDuet-ydaO plasmid strain was used as the control strain ControlY. The two strains were cultured overnight in LB medium (200 rpm, 37° C.) supplemented with appropriate antibiotics. Overnight LB cultures were inoculated at 1% (v / v) into fresh M9 medium for fermentation. When the biomass of the bacteria was 0.4-0.6 at OD600, the cells were induced with different concentrations of the inducer IPTG, and then fermented at 30°C and 200rpm. The experiment was recorded as Normal in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombinant plasmid for promoting glutathione synthesis by dynamically regulating ATP, an engineering bacterium and an application thereof, and belongs to the technical field of fermentation. In the invention, a gene recombination technology is utilized; firstly, a riboswitch ydaO module, a ppk gene, a gshf gene segment and a plasmid vector are recombined to construct arecombinant plasmid; and then, the recombinant plasmid is transferred into an escherichia coli competent state, and an ATP regulation and control method based on the riboswitch ydaO module and polyphosphokinase (ppk) is constructed in escherichia coli so that an ATP concentration can be controlled at a certain level, and synthesis of intracellular ATP dependent products is facilitated.

Description

technical field [0001] The invention belongs to the field of fermentation technology, and specifically relates to a recombinant plasmid, an engineering bacterium and an application thereof for promoting glutathione synthesis through dynamic regulation of ATP. Background technique [0002] Glutathione (GSH) is a biologically active small molecular substance that widely exists in cells and plays important physiological functions in organisms. GSH plays an important role in maintaining a suitable redox environment in the body. At the same time, glutathione has the functions of improving the body's immunity and anti-oxidation, and has a wide range of uses in the fields of clinical medicine and food processing. Glutathione uses glutamic acid, cysteine, and glycine gluten as substrates in the cell, through γ-glutamylcysteine ​​synthetase (γ-GCS, EC 6.3.2.2) and glutathione Synthetases (GS, EC 6.3.2.3) catalyze the synthesis of these three substrate amino acids in the presence of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C12P21/02C07K5/037
CPCC12N15/70C12N9/1229C12Y207/04001C12P21/02C07K5/0215
Inventor 陈雅维柴骏廖源孔维臻王书涵
Owner HENAN UNIV OF SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More