Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving sensitivity of nicotiana tabacum to cadmium

A sensitivity and tobacco technology, applied in the field of research on the influence of cadmium on tobacco growth, can solve the problems of cell internal structure damage, slow plant growth, inactivation, etc., to avoid the aggravation of heavy metal Cd pollution, reduce the concentration of cadmium in the environment, and reduce the tolerance The effect of cadmium

Pending Publication Date: 2020-06-26
SHANDONG AGRICULTURAL UNIVERSITY
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term absorption and accumulation will promote plant cells to produce a large amount of active oxygen, promote protein denaturation and inactivation, and then damage plant cell membranes, cause damage to the internal structure of cells, disrupt cell metabolism balance, cause spots on leaves, reduce photosynthetic efficiency, and cause slow plant growth , short plants, and even cause plant disease and death, ultimately affecting crop yield and quality (Chen Aikui et al., 2013; Ma Yanhua et al., 2014)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving sensitivity of nicotiana tabacum to cadmium
  • Method for improving sensitivity of nicotiana tabacum to cadmium
  • Method for improving sensitivity of nicotiana tabacum to cadmium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0029] Embodiment: a kind of method that improves tobacco cadmium sensitivity

[0030] MhNRAMP6 was overexpressed in tobacco by leaf disc dipping method. The length of the open reading frame (ORF) of MhNRAMP6 gene was 1638bp, encoding a protein containing 545 amino acids, and its protein molecular weight was predicted to be 59.12kD. It was located in the plasma membrane and had 11 strong transmembrane helices; their nucleotide sequence is shown in SEQ No.1. Specific steps are as follows:

[0031] (1) PCR amplified pMD18-T-MhNRAMP6 using specific primers with restriction sites, and the product was recombined with pROKII to construct a plant overexpression vector pROKII-MhNRAMP6 containing the MhNRAMP6 gene, which was transformed into Agrobacterium GV3101 to obtain the The positive strain of the expression vector of the target fragment; the specific primers and enzyme cutting sites are:

[0032] F: CGGGAATGGCTGTGGCCAGTACGG (BamHI);

[0033] R: GGGGTAGGTCTACCGAAAATATCGA (KpnI)...

experiment example

[0040] 1 test material

[0041] 1.1 Tobacco

[0042] The tobacco variety is NC89, which grows to about 4-5 leaves.

[0043] 1.2 Strains and vectors

[0044]The strains used in this experiment: Trans 5α for Escherichia coli and GV3101 for Agrobacterium, both were purchased from Beijing Quanshijin Biotechnology (TRANS) Company. The yeast strain is BY4741, commercially available.

[0045]

[0046] 1.3 Enzymes, kits and primers

[0047] Restriction endonucleases, EasyTaq enzymes, and TransTaq HiFi DNA Polymerase were purchased from Beijing Quanshijin Biotechnology (TRANS) Company.

[0048] cDNA Reverse Transcription Kit (PrimeScript TM II 1st Strand cDNA Synthesis Kit, 6210A), reverse transcription kit PrimeScript TM RT reagent Kit with gDNAEraser (Perfect RealTime, TaKaRa, RR047A) and fluorescent real-time quantitative PCR kit TB Green TM Premix Ex Taq TM II (TaKaRa, RR820Q) was provided by Treasure Biological Company; RNAprep Pure Polysaccharide Polyphenol Plant T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for improving sensitivity of nicotiana tabacum to cadmium, and in particular relates to the method of overexpressing MhNRAMP6 in the nicotiana tabacum by using a leafdisc infiltration process. The length of the open reading frame (ORF) of the MhNRAMP6 gene is 1638 bp, a protein containing 545 amino acids is encoded, the protein molecular weight is predicted to be59.12 kD, and the MhNRAMP6 is located in a plasma membrane, and has 11 strong transmembrane helices; and the nucleotide sequence is shown as SEQ No.1. The nicotiana tabacum containing the overexpression gene MhNRAMP6 is more sensitive to the cadmium, so that the tolerance of the nicotiana tabacum to the cadmium is reduced, the problem that the nicotiana tabacum generates various stress reactionsbecause heavy metal Cd pollution in tobacco growing areas is increased is avoided, and the absorption of the cadmium by nicotiana tabacum roots is increased to enrich environmental cadmium to achievethe purpose of reducing the concentration of cadmium in the external environment.

Description

technical field [0001] The invention relates to a method for improving tobacco cadmium sensitivity, which belongs to the research field of the influence of cadmium on tobacco growth. Background technique [0002] Cadmium (Cd) is a heavy metal with strong toxicity, which can inhibit plant growth at a low concentration. Long-term absorption and accumulation will promote plant cells to produce a large amount of active oxygen, promote protein denaturation and inactivation, and then damage plant cell membranes, cause damage to the internal structure of cells, disrupt cell metabolism balance, cause spots on leaves, reduce photosynthetic efficiency, and cause slow plant growth , short plants, and even cause plant disease and death, ultimately affecting crop yield and quality (Chen Aikui et al., 2013; Ma Yanhua et al., 2014). With the development of industrialization, the pollution of water sources and the discharge of waste gas have caused the cadmium content in some soils used fo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/29A01H4/00A01H5/00A01H6/82
CPCA01H4/001A01H4/008C07K14/415C12N15/8259
Inventor 张玮玮岳松青宋建飞石钧元杨洪强
Owner SHANDONG AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products