Method for improving sensitivity of nicotiana tabacum to cadmium
A sensitivity and tobacco technology, applied in the field of research on the influence of cadmium on tobacco growth, can solve the problems of cell internal structure damage, slow plant growth, inactivation, etc., to avoid the aggravation of heavy metal Cd pollution, reduce the concentration of cadmium in the environment, and reduce the tolerance The effect of cadmium
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0029] Embodiment: a kind of method that improves tobacco cadmium sensitivity
[0030] MhNRAMP6 was overexpressed in tobacco by leaf disc dipping method. The length of the open reading frame (ORF) of MhNRAMP6 gene was 1638bp, encoding a protein containing 545 amino acids, and its protein molecular weight was predicted to be 59.12kD. It was located in the plasma membrane and had 11 strong transmembrane helices; their nucleotide sequence is shown in SEQ No.1. Specific steps are as follows:
[0031] (1) PCR amplified pMD18-T-MhNRAMP6 using specific primers with restriction sites, and the product was recombined with pROKII to construct a plant overexpression vector pROKII-MhNRAMP6 containing the MhNRAMP6 gene, which was transformed into Agrobacterium GV3101 to obtain the The positive strain of the expression vector of the target fragment; the specific primers and enzyme cutting sites are:
[0032] F: CGGGAATGGCTGTGGCCAGTACGG (BamHI);
[0033] R: GGGGTAGGTCTACCGAAAATATCGA (KpnI)...
experiment example
[0040] 1 test material
[0041] 1.1 Tobacco
[0042] The tobacco variety is NC89, which grows to about 4-5 leaves.
[0043] 1.2 Strains and vectors
[0044]The strains used in this experiment: Trans 5α for Escherichia coli and GV3101 for Agrobacterium, both were purchased from Beijing Quanshijin Biotechnology (TRANS) Company. The yeast strain is BY4741, commercially available.
[0045]
[0046] 1.3 Enzymes, kits and primers
[0047] Restriction endonucleases, EasyTaq enzymes, and TransTaq HiFi DNA Polymerase were purchased from Beijing Quanshijin Biotechnology (TRANS) Company.
[0048] cDNA Reverse Transcription Kit (PrimeScript TM II 1st Strand cDNA Synthesis Kit, 6210A), reverse transcription kit PrimeScript TM RT reagent Kit with gDNAEraser (Perfect RealTime, TaKaRa, RR047A) and fluorescent real-time quantitative PCR kit TB Green TM Premix Ex Taq TM II (TaKaRa, RR820Q) was provided by Treasure Biological Company; RNAprep Pure Polysaccharide Polyphenol Plant T...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



