Method for rapidly and efficiently extracting DNA (Desoxvribose Nucleic Acid) from milk products such as liquid milk and milk powder
A technology for liquid milk and milk powder, applied in the field of molecular biology, can solve the problems of easy degradation, time-consuming and low DNA concentration, and achieve the effect of preventing DNA degradation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Milk, goat milk and milk powder genomic DNA extraction steps are as follows:
[0038] Step 1, reagent preparation and experimental equipment preparation:
[0039] 1. The centrifuge tube is prepared to use a 2ml centrifuge tube, sterilized in an autoclave, and set aside;
[0040] 2. PBS (phosphate buffer solution) is prepared as follows: Phosphate buffer solution (pBs): Weigh NaCL8g, KCL0.2g, NaCL 2 HPO 4 1.44g, K 2 HPO 4 0.24g, dissolve various substances in 800mL double distilled water, adjust the pH to 7.4, add double distilled water to make the volume to 1L;
[0041]3. Preparation of 5-10% Chelex-100 suspension: Weigh Chelex-1005-10g, dissolve in 95-90ml double distilled water, and shake well before use;
[0042] 4. Preparation of TE buffer solution: Weigh 1M / LTris-cl0.5M / L and EDTA-Na0.5M / LPH with a pH of 8.0 and adjust them to 7.0-8.0.
[0043] Step 2, leukocyte collection
[0044] ① Dissolve 1-2ml of milk or goat milk, or 2mg of milk powder in 2ml...
Embodiment 2
[0060] This example purchases fresh liquid milk from Xingniu Dairy Co., Ltd. of Animal Husbandry of Shandong Academy of Agricultural Sciences: milk and goat's milk, and purchases liquid milk and milk powder such as pure milk, pure goat's milk, yogurt and so on of different brands from major shopping malls in Jinan according to the present invention Genomic DNA in milk samples was extracted using the method, and the extracted genome was detected using Nanodrp (micro-ultraviolet spectrophotometer). The data obtained are shown in Table 1. For agarose gel electrophoresis, see figure 1 .
[0061] Table 1 Milk sample DNA purity and concentration determination results
[0062]
[0063] It can be seen from Table 1 that OD 260 / 280 If the value is within the range of 1.8-2.0, the DNA purity meets the requirements, and the purity and concentration of the genomic DNA of various types of milk extracted by the present invention can meet the requirements, but the concentration is signifi...
Embodiment 3
[0065] Ordinary PCR to detect the purification effect of DNA extraction:
[0066] This example uses the genomic DNA extracted from different brands of liquid milk and milk powder in Example 2 as a template, selects the mitochondrial 16SrRNA gene as the research object, searches for the gene sequence in GeneBank, and designs specific universal primers for cattle or sheep , carry out PCR amplification, and detect the amplification effect.
[0067] 1. Primer sequence:
[0068] Forward primer: AAGACGAGAAGGGAACCCTTGGAC
[0069] Reverse primer: GCGCTGTTTAATCCCCATAGG
[0070] 2. PCR reaction
[0071] (1) Perform PCR amplification with the liquid milk and milk powder genomic DNA of different brands extracted in Example 2 as a template, and the 25 μL reaction system includes the following solutions or reagents:
[0072]
[0073] (2) After exploring the experimental conditions by gradient PCR, the annealing temperature was finally determined to be 58°C, and the PCR reaction condi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 