Check patentability & draft patents in minutes with Patsnap Eureka AI!

Nucleic acid aptamer and construction method thereof and application thereof in detecting soft-shelled turtle iridovirus

A nucleic acid aptamer and Chinese soft-shelled turtle technology, applied in the field of bioengineering, can solve the problems of unsatisfactory rapid and accurate detection and diagnosis, expensive instruments and reagents, cumbersome operations, etc., and achieve convenient chemical synthesis in vitro, short preparation cycle, simple and rapid operation Effect

Active Publication Date: 2020-07-03
GUANGXI ACAD OF SCI
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection results of PCR technology are accurate and reliable, but there are disadvantages such as cumbersome operation, long time-consuming, expensive instruments and reagents, etc., which cannot meet the requirements of rapid and accurate detection and diagnosis on site

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid aptamer and construction method thereof and application thereof in detecting soft-shelled turtle iridovirus
  • Nucleic acid aptamer and construction method thereof and application thereof in detecting soft-shelled turtle iridovirus
  • Nucleic acid aptamer and construction method thereof and application thereof in detecting soft-shelled turtle iridovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Screening and preparation of nucleic acid aptamers for detection of STIV

[0023] S1. Construction of the first ssDNA library and synthesis of primers

[0024] The first ssDNA library Library 50 was designed and synthesized. Its nucleotide sequence is as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, where both ends are fixed sequences and the middle 50 nucleotides are random sequences.

[0025] The upstream primer includes the DNA sequence shown in SEQ ID NO.3, and is labeled with hydroxyfluorescein (FAM), and its specific sequence is: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.

[0026] The downstream primer includes the DNA sequence shown in SEQ ID NO.4 and is labeled with Biotin, and its specific sequence is: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0027] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0028] S2. SELEX screening to obtain nucleic acid aptamers that specifically recognize STIV-infec...

Embodiment 2

[0046] 2.1 Main Instruments

[0047] Attune NxT flow cytometer (Thermo Fisher Scientific), FV3000 laser scanning confocal microscope (Olympus).

[0048] 2.2 Experimental group setting method

[0049] The nucleic acid aptamer of SEQ ID NO.1 and the nucleic acid aptamer of SEQ ID NO.2 constructed in Example 1 were respectively labeled with FAM.

[0050] Experimental group I: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.1 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into ice, and bathe in ice for 10 minutes, and mix the treated first ssDNA library with STIV-infected fat The head carp cells were incubated on ice for 1 h, and after the incubation and binding were completed, the supernatant was removed by centrifugation.

[0051] Experiment Group II: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.2 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid aptamer and a construction method thereof and an application thereof in detecting soft-shelled turtle iridovirus. The nucleic acid aptamer comprises a DNA sequence shown in SEQ ID NO.1 or a derivative thereof. The nucleic acid aptamer provided by the invention has higher affinity and specificity for the soft-shelled turtle iridovirus, and in addition has the advantages such as non-immunogenicity, short preparation cycle, good reproducibility, small molecular weight, being convenient for in vitro chemical synthesis, being convenient for labeling, being easyto modify and replace different parts of the nucleic acid aptamer, stable sequence, and being easy to transport and store. When a rapid detection method based on the nucleic acid aptamer of the invention is used to detect the soft-shelled turtle iridovirus, the operation is simple and rapid, and relatively high accuracy and sensitivity can be achieved. The nucleic acid aptamer can be used to construct molecular probes or detection kits, and is combined with detection equipment such as microplate reader, flow cytometer and fluorescence microscope to realize accurate detection of the soft-shelled turtle iridovirus.

Description

[0001] This application is required to be submitted to the State Intellectual Property Office on February 07, 2020. The application number is CN202010082168.7, and the title of the invention is "a nucleic acid aptamer and its construction method and its application in the detection of Chinese soft-shelled turtle rainbow virus". The priority of the Chinese patent application, the entire content of which is incorporated in this application by reference. technical field [0002] The invention belongs to the technical field of bioengineering, and in particular relates to a nucleic acid aptamer, its construction method and its application in the detection of Chinese soft-shelled turtle rainbow virus. Background technique [0003] Soft-shelled turtles are rich in nutrition and have high medicinal value. As a large-scale and important aquaculture species in my country, the annual production of domestic soft-shelled turtles has reached more than 300,000 tons, and the direct output va...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/115C12N15/10G01N33/569
CPCC12N15/115C12N15/1048G01N33/56983C12N2310/16C12N2310/532
Inventor 李鹏飞余庆刘明珠肖贺贺吴思婷
Owner GUANGXI ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More