Nucleic acid aptamer and construction method thereof and application thereof in detecting soft-shelled turtle iridovirus
A nucleic acid aptamer and Chinese soft-shelled turtle technology, applied in the field of bioengineering, can solve the problems of unsatisfactory rapid and accurate detection and diagnosis, expensive instruments and reagents, cumbersome operations, etc., and achieve convenient chemical synthesis in vitro, short preparation cycle, simple and rapid operation Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Screening and preparation of nucleic acid aptamers for detection of STIV
[0023] S1. Construction of the first ssDNA library and synthesis of primers
[0024] The first ssDNA library Library 50 was designed and synthesized. Its nucleotide sequence is as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, where both ends are fixed sequences and the middle 50 nucleotides are random sequences.
[0025] The upstream primer includes the DNA sequence shown in SEQ ID NO.3, and is labeled with hydroxyfluorescein (FAM), and its specific sequence is: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.
[0026] The downstream primer includes the DNA sequence shown in SEQ ID NO.4 and is labeled with Biotin, and its specific sequence is: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.
[0027] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.
[0028] S2. SELEX screening to obtain nucleic acid aptamers that specifically recognize STIV-infec...
Embodiment 2
[0046] 2.1 Main Instruments
[0047] Attune NxT flow cytometer (Thermo Fisher Scientific), FV3000 laser scanning confocal microscope (Olympus).
[0048] 2.2 Experimental group setting method
[0049] The nucleic acid aptamer of SEQ ID NO.1 and the nucleic acid aptamer of SEQ ID NO.2 constructed in Example 1 were respectively labeled with FAM.
[0050] Experimental group I: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.1 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into ice, and bathe in ice for 10 minutes, and mix the treated first ssDNA library with STIV-infected fat The head carp cells were incubated on ice for 1 h, and after the incubation and binding were completed, the supernatant was removed by centrifugation.
[0051] Experiment Group II: Dissolve 10 nmol of the nucleic acid aptamer of SEQ ID NO.2 in 500 μL of PBS, bathe in constant temperature water at 92°C for 5 minutes, then quickly insert it into i...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com