Anti-diabetic pancreatic beta cells with down-regulated SLC30A8 gene expression and application thereof

A gene expression, β-cell technology, applied in pancreatic cells, genetically modified cells, cells modified by introducing foreign genetic material, etc., to achieve the effect of improving sensitivity, promoting maturation, and highly anti-apoptotic ability

Active Publication Date: 2020-07-14
TONGJI UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no report on the in-depth study of the function of the SLC30A8 gene in human islet β cells, and there is no report that can combine stem cell differentiation technology and CRISPR / Cas9 gene editing technology to study the development and function of human islet β cells Maturation process, pathogenesis and treatment of diabetes mellitus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-diabetic pancreatic beta cells with down-regulated SLC30A8 gene expression and application thereof
  • Anti-diabetic pancreatic beta cells with down-regulated SLC30A8 gene expression and application thereof
  • Anti-diabetic pancreatic beta cells with down-regulated SLC30A8 gene expression and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Construction of Human Embryonic Stem Cell Line with SLC30A8 Gene Knockout

[0033] 1 Plasmid construction

[0034] (1) Plasmid design and sgRNA screening

[0035] Use the tool website (http: / / crispr.mit.edu / ) to design a 23bp sgRNA for the upstream and downstream of the exon near the 5' end of the human SLC30A8 gene, and insert it into the carrying In the vector of Cas9 protein gene and puromycin resistance gene. According to the sgRNA target position and off-target rate score, the following sgRNAs were screened out:

[0036] sgRNA1 (SEQ ID NO.1): GACTGGCGTGCTAGTGTACCTGG;

[0037] sgRNA2 (SEQ ID NO. 2): CGATGATCATCACAGTCGCCTGG.

[0038]The plasmid sequence is as follows (SEQ ID NO.3):

[0039]

[0040] (2) Plasmid transformation and sequencing

[0041] Thaw the chemically competent cells for cloning on ice, add 10 μL of the ligation product to 100 μL of competent cells, flick the tube wall to mix well, let stand on ice for 30 minutes, heat shock in a water bath at ...

Embodiment 2

[0056] Effect of SLC30A8 Gene Knockout on the Promotion of Insulin Secretion in β Cells

[0057] The ability to secrete insulin in response to glucose stimulation is an important indicator of pancreatic β-cell function. The islet β cells induced to differentiate and mature in Example 1 were used as the SLC30A8 gene knockout group (SLC30A8), and compared with the wild control (WT) β cells without gene editing, the in vivo and in vitro functions were detected by the following methods, and the research Effect of SLC30A8 Gene Knockout on Insulin Secretion

[0058] 1 In vitro function test

[0059] In vitro studies mainly detect the insulin synthesis and secretion function of mature islet β cells. In terms of insulin synthesis, we monitored the conversion efficiency of proinsulin to insulin: using the difference in the recognition sites of proinsulin and insulin antibodies, the proinsulin-positive and insulin-positive cells were screened by flow cytometry, and the statistics The...

Embodiment 3

[0068] Example 3 Study of SLC30A8 Gene Knockout on Beta Cell Resistance to Type 2 Diabetes

[0069] The islet β cells of the SLC30A8 gene knockout group induced to differentiate and mature in Example 1 and the wild control group were used to study the mechanism of the SLC30A8 gene knockout islet β cells resisting the onset of type 2 diabetes by the following method.

[0070] 1 In vitro simulation of lipotoxic β-cell apoptosis induced by palmitic acid

[0071]The SLC30A8 gene knockout group and the wild control group were respectively formed into two groups of control groups (Control, Ct) and two groups plus 1mM palmitic acid solution group (PA). After culturing, the cell spheres were taken out for Annexin V living cell staining (this dye can identify early apoptotic cells), and confocal microscopy was performed to count the expression of Annexin V. Such as Figure 5 As shown, the results showed that under palmitic acid stimulation, the number of early apoptotic β cells in th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, and particularly relates to anti-diabetic pancreatic beta cells with down-regulated SLC30A8 gene expression and application thereof. A large number of pancreatic beta cells with the anti-diabetic function are obtained through induced differentiation, the regulation and control effect of SLC30A8 genes on the human pancreatic beta cell function maturation process is discussed, the human pancreatic beta cell function maturation process is regulated and controlled in an in-vitro induced differentiation system, the blood glucose sensitivity of the human pancreatic beta cells is improved, the human pancreatic beta cells are efficiently and directionally differentiated into functional pancreatic beta cells with the anti-apoptosis and efficient insulin secretion capacity, and a new thought is provided for diabetes mechanism research and diabetes stem cell treatment.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to an anti-diabetic islet beta cell with down-regulated expression of SLC30A8 gene and application thereof. Background technique [0002] Diabetes is extremely harmful to human health. Worldwide, the prevalence and incidence of diabetes and the number of diabetic patients have risen sharply. According to statistics from the International Diabetes Federation, the number of diabetic patients in the world has reached 425 million in 2017, an increase of nearly 16% from 366 million in 2011. China has It has become the world's largest country in the incidence of diabetes, and the development situation is very grim. Diabetes is mainly divided into type 1 and type 2, and type 2 diabetes is more common. Type 2 diabetes is associated with aging and obesity. The peripheral target organs of patients develop resistance to insulin, resulting in a relative deficiency of insulin secretion. In type 2...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/071C12N5/10C12N15/85C12N15/90C12N15/12A61K35/39A61P3/10
CPCC12N5/0676C12N15/85C12N15/907C07K14/47A61K35/39A61P3/10C12N2500/34C12N2506/02C12N2510/00C12N2800/107
Inventor李维达马青
OwnerTONGJI UNIV