Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple nano-fluorescence quantitative hypersensitive modelling detection kit

A fluorescent quantitative and kit technology, which is applied in the field of detection primers and multiple nano-fluorescent quantitative ultrasensitive large-scale detection kits, can solve the problems that the multiple detection technology of viral nucleic acid has not been reported, so as to ensure healthy and sustainable development and benefit The effect of application promotion and high detection rate

Pending Publication Date: 2020-07-31
NORTHWEST A & F UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] At present, among the nucleic acid detection methods for detecting porcine blue ear disease virus, swine fever virus, porcine circovirus type 2, porcine pseudorabies virus and porcine parvovirus, the most sensitive method is fluorescent quantitative PCR, which is more sensitive than fluorescent quantitative PCR. Viral nucleic acid multiple detection technology has not been reported yet

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple nano-fluorescence quantitative hypersensitive modelling detection kit
  • Multiple nano-fluorescence quantitative hypersensitive modelling detection kit
  • Multiple nano-fluorescence quantitative hypersensitive modelling detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 Design and Screening of Enrichment Probes and Amplified Tags

[0054] In the functionalized magnetic beads coupled with enrichment probes to capture viral nucleic acids, the functionalized gold nanoparticles coupled with amplification tags to enrich virus signals and fluorescent quantitative PCR detection, the design of enrichment probes and amplification tags directly affects detection specificity and sensitivity. After fully considering relevant factors, the present invention designed two groups of probes and labels based on the research experience of our laboratory, and found that the following probes, labels and corresponding detection probes and primers showed good specificity and sensitivity.

[0055] The relevant sequence is as follows:

[0056] Porcine PRRS virus enrichment probe (SEQ ID NO:1):

[0057] 5'NH2-T15CCAGGTTTCTATGGCTGAGTACAC

[0058] Porcine PRRS virus amplification tag (SEQ ID NO:2):

[0059] 5'SH-T5GTTGGCTCTGGTGCAGGGTCCGAGGTATTGTAACGG...

Embodiment 2

[0117] Embodiment 2 kit composition, method of use and shelf life test

[0118] 1. Kit composition

[0119] According to the physical and chemical properties and functional divisions of the kit, the kit is divided into three parts: A, B and C. Part A is the virus nucleic acid release reagent, hybridization reagent and magnetic beads coupled with enrichment probes, and part B is the coupling reagent. The gold nano solution with the amplification label is connected, and the C part is the fluorescent quantitative PCR detection reagent part, which is convenient for storage and transportation.

[0120] The nucleotide sequences involved in the kit (including enrichment probes, amplification labels, detection probes, detection primers, and positive controls) are the same as in Example 1.

[0121] In addition, a small magnetic stand is required.

[0122] Part A

[0123] 1) One bottle of solution A1 (virus lysate), 25mL; its components are: 15mM Tris-HCl, 1mM EDTA, 10mMNaCl;

[012...

Embodiment 3

[0166] Embodiment 3 kit specificity

[0167] This embodiment is used to illustrate that the kit provided by the present invention (the kit of Example 2) is used for amplifying porcine blue ear disease virus, swine fever virus, porcine circovirus type 2, porcine pseudorabies virus and porcine parvovirus specificity.

[0168] Including swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV) and / or serum samples of 7 pathogens such as porcine transmissible gastroenteritis virus (TGEV) or serum samples containing only some of these pathogens and established positive controls, negative controls according to the method described in Example 2 to test.

[0169] Kit effectiveness judgment:

[0170] Positive control: Ct value ≤ 35, with obvious exponential growth;

[0171] Negative control: Ct value > 45 or no Ct value, l...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of animal virus detection, and relates to a multiple hypersensitive nano fluorescence detection kit for porcine reproductive and respiratory syndrome virus, hog cholera virus, porcine circovirus type 2, porcine pseudorabies virus and porcine parvovirus. The kit can simultaneously screen and identify the five viruses, has the sensitivity of 20copies / mL,and realizes the large-scale screening and identification of early animal samples infected by the five pathogens. The kit has the advantages of high flux, high sensitivity, strong specificity, avoidance of pathogen nucleic acid extraction and reverse transcription, can improve the detection rate of the early pathogens, effectively prevents and controls the propagation of the five diseases, and isof great significance to the healthy development of the pig industry.

Description

technical field [0001] The invention relates to the technical field of animal virus detection, in particular to a multiple nanometer-fluorescent device capable of simultaneously detecting and differentially diagnosing porcine blue ear disease virus, swine fever virus, porcine circovirus type 2, porcine pseudorabies virus and porcine parvovirus Quantitative ultrasensitive scale-up detection (UNDP-MFQ) kit and enrichment probes, amplification labels, detection probes and detection primers. Background technique [0002] Pig farming is a key pillar industry of animal husbandry in my country. With the development of intensive pig farming in recent years, porcine reproductive and respiratory syndrome (commonly known as blue ear disease) virus (PRRSV), swine fever virus (CSFV), swine Circovirus type 2 (PCV2), porcine pseudorabies virus (PRV) and porcine parvovirus (PPV) alone or mixed infection caused reproductive disorders in sows and multisystemic diseases in piglets have become a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
CPCC12Q1/701C12Q1/6851C12Q2600/16C12Q2600/166C12Q2537/143C12Q2561/101C12Q2563/107C12Q2527/125C12Q2545/113Y02A50/30
Inventor 黄勇童德文罗乐
Owner NORTHWEST A & F UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com