Multiple nano-fluorescence quantitative hypersensitive modelling detection kit
A fluorescent quantitative and kit technology, which is applied in the field of detection primers and multiple nano-fluorescent quantitative ultrasensitive large-scale detection kits, can solve the problems that the multiple detection technology of viral nucleic acid has not been reported, so as to ensure healthy and sustainable development and benefit The effect of application promotion and high detection rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1 Design and Screening of Enrichment Probes and Amplified Tags
[0054] In the functionalized magnetic beads coupled with enrichment probes to capture viral nucleic acids, the functionalized gold nanoparticles coupled with amplification tags to enrich virus signals and fluorescent quantitative PCR detection, the design of enrichment probes and amplification tags directly affects detection specificity and sensitivity. After fully considering relevant factors, the present invention designed two groups of probes and labels based on the research experience of our laboratory, and found that the following probes, labels and corresponding detection probes and primers showed good specificity and sensitivity.
[0055] The relevant sequence is as follows:
[0056] Porcine PRRS virus enrichment probe (SEQ ID NO:1):
[0057] 5'NH2-T15CCAGGTTTCTATGGCTGAGTACAC
[0058] Porcine PRRS virus amplification tag (SEQ ID NO:2):
[0059] 5'SH-T5GTTGGCTCTGGTGCAGGGTCCGAGGTATTGTAACGG...
Embodiment 2
[0117] Embodiment 2 kit composition, method of use and shelf life test
[0118] 1. Kit composition
[0119] According to the physical and chemical properties and functional divisions of the kit, the kit is divided into three parts: A, B and C. Part A is the virus nucleic acid release reagent, hybridization reagent and magnetic beads coupled with enrichment probes, and part B is the coupling reagent. The gold nano solution with the amplification label is connected, and the C part is the fluorescent quantitative PCR detection reagent part, which is convenient for storage and transportation.
[0120] The nucleotide sequences involved in the kit (including enrichment probes, amplification labels, detection probes, detection primers, and positive controls) are the same as in Example 1.
[0121] In addition, a small magnetic stand is required.
[0122] Part A
[0123] 1) One bottle of solution A1 (virus lysate), 25mL; its components are: 15mM Tris-HCl, 1mM EDTA, 10mMNaCl;
[012...
Embodiment 3
[0166] Embodiment 3 kit specificity
[0167] This embodiment is used to illustrate that the kit provided by the present invention (the kit of Example 2) is used for amplifying porcine blue ear disease virus, swine fever virus, porcine circovirus type 2, porcine pseudorabies virus and porcine parvovirus specificity.
[0168] Including swine fever virus (CSFV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine circovirus type 2 (PCV2), porcine parvovirus (PPV), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV) and / or serum samples of 7 pathogens such as porcine transmissible gastroenteritis virus (TGEV) or serum samples containing only some of these pathogens and established positive controls, negative controls according to the method described in Example 2 to test.
[0169] Kit effectiveness judgment:
[0170] Positive control: Ct value ≤ 35, with obvious exponential growth;
[0171] Negative control: Ct value > 45 or no Ct value, l...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


