Method for evaluating animal model during screening of neoantigen vaccines or drugs and application of method
A technology of animal models and antigen vaccines, which is applied in biochemical equipment and methods, microbial measurement/inspection, animal husbandry, etc., and can solve the problems of unstable expression, small base differences in different segments, and unstable test results, etc. problem, to achieve the effect of simple experimental operation and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Primer design:
[0060] 1) Select human genes with high efficiency and stable expression, and copy the cDNA sequences of GUSB (NM_000181) and HPRT1 (NM_000194) reference genes;
[0061] 2) Select candidates with an amplicon length of 70-150bp, a primer length of 18-25bp, and a Tm value of 59°C±5°C; a probe length of 20-27bp, and a Tm value of the primer Tm value+10°C±5°C Primers and probes;
[0062] 3) Sequence-specific alignment of the candidate primers and probes to determine the candidate primers and probes (Table 1).
[0063] Table 1. Primer and Probe Sequences
[0064]
[0065] Primer concentration optimization:
[0066] For a 20 μL reaction system, 2×Taqman Universal Master Mix II is 10 μL; the probe concentration is 250 nM; the template concentration is 100 ng; GUSB and HPRT1 gene primers (SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.4, The upstream and downstream concentrations of SEQ ID NO.5) are respectively set: 100nM, 200nM, 400nM, 800nM, and the orthogonal ex...
Embodiment 2
[0071] The establishment of the kit:
[0072] A kit for detecting human-derived circulating tumor cells, mainly comprising:
[0073] 1) Reverse transcription primer: Oligo(dT) 20 ;
[0074] 2) Specific primers: PF1: CGGTCTGTACTTCTGTAC (SEQ ID NO.1), PR1: GACAGAGATCTGGTAATTCA (SEQ ID NO.2); PF2: AGCCTAAGATGAGAGTTC (SEQ ID NO.4), PR2: CACAGAACTAGAACATTGATA (SEQ ID NO.5);
[0075] 3) Specific probe: P1: CACTGTCTTGCTCCACGCTG (SEQ ID NO.3), the 5' end of the sequence is modified with a FAM fluorescent group, and the 3' end is modified with NFQ-MGB; P2: ATCTGGAGTCCTATTGACATCGCC (SEQ ID NO.6), the sequence The 5' end is modified with VIC fluorescent group, and the 3' end is modified with NFQ-MGB;
[0076] 4) Reverse transcription reaction solution: including RNA reverse transcriptase, 10× buffer, DTT, dNTPs, RNaseOUTRecombinant RNase Inhibitor, RNase H;
[0077] 5) qPCR reaction solution: AmpliTaq Gold DNA polymerase, dUTP, dNTPs, ROX fluorescence control, PCR reaction buffer.
Embodiment 3
[0079] 1) Extraction of RNA, digestion of DNA:
[0080] According to the nature of the sample, use the corresponding RNA extraction kit to extract the sample RNA, and perform genome elimination, take 1 μL for nucleic acid quantification, 5 μL for nucleic acid electrophoresis identification, and use DEPC water to dilute the extracted RNA to 10-100ng / μL for later use.
[0081] 2) Preparation of cDNA:
[0082] Prepare the reaction solutions for the extracted sample RNA according to the following system:
[0083]
[0084] 3) Real-time quantitative RT-PCR reaction:
[0085] Using the GUSB, HPRT1 primers and probes designed above, the prepared human tumor cells MDA-MB-231, SK-BR-3, SMMC-7721, Hep G2, HT-29, Caco-2, A549, NCI -H2227 and mouse cell RAW 264.3, MEL, L7912 cDNA for real-time quantitative PCR detection, the steps are as follows:
[0086]
[0087] Mouse-derived cells RAW264.3, MEL, L7912 showed no amplification after real-time quantitative PCR detection using GUSB...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More