Thyroid cancer auxiliary molecule diagnosis test kit and use method

A molecular diagnosis, thyroid cancer technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of reduced PCR efficiency, primer extension block, short detection time, etc., to achieve good specificity and improved accuracy. Good reproducibility and repeatability

Inactive Publication Date: 2020-08-14
重庆浦洛通基因医学研究院有限公司
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The principle is that the primer extension guided by DNA polymerase starts from the 3' end of the primer in the PCR process, and the degree of complementary pairing between the base at the 3' end of the primer and the template strongly affects the recognition of the polymerase and the progress of the PCR reaction: if This base is normally complementary to the template (A-T, G-C), the primer can be extended without interruption, PCR can be efficiently performed, and a complete product is obtained; on the contrary, if this base is not normally paired with the template, the extension of the primer is blocked , the PCR efficiency is greatly reduced
Conventional ARMS-PCR technology is easy to operate, the detection time is short, and the detection sensitivity is generally around 1%. If combined with fluorescence quantitative technology, the detection efficiency can reach 0.5%.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thyroid cancer auxiliary molecule diagnosis test kit and use method
  • Thyroid cancer auxiliary molecule diagnosis test kit and use method
  • Thyroid cancer auxiliary molecule diagnosis test kit and use method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1: Primer and probe combination design and use

[0044] The present invention collects BRAF (p.V600E), HRAS (p.Q61R), KRAS (p.G13D), KRAS (p.G13R), KRAS (p.G12D), KRAS (p.G12C), NRAS (p.Q61H ), NRAS(p.Q61P), NRAS(p.Q61K), TERT(C228T) and TERT(C250T) 5 genes sequence information of 12 kinds of mutation sites, after large-scale experimental screening, the optimal primers and The probes are as follows:

[0045] (1) Amplification primer pair and probe for detecting BRAF gene V600E

[0046] BRAF-F: GTGATTTTGGTCCAGCCAGAAA

[0047] BRAF-R: TCTAGTAACTCAGCAGCATCTCAGG

[0048] BRAF-P: FAM-ACTGATGGGACCCACTCCATCGA-TAMRA

[0049] (2) Amplification primer pair and probe for detection of HRAS gene Q61R

[0050] HQ61R-F5:CATCCTGGATACCGCCGTCAG

[0051] HQ61R-R:CTTGGTGTTGTTGATGGCAAAC

[0052] HQ61R-P: FAM-AGGAGTACAGCGCCATGCGGGA-TARMA

[0053] (3) Amplification primer pair and probe for detecting KRAS gene G12C

[0054] KG12C-F3:TATAAACTTGTGGTAGTTGGAGCCT

[0055] K1213-R...

Embodiment 2

[0107] Example 2: Acquisition of Positive Quality Controls

[0108] The method of obtaining positive quality control products is: according to BRAF(p.V600E), HRAS(p.Q61R), KRAS(p.G13D), KRAS(p.G13R), KRAS(p.G12D), KRAS published on NCBI (p.G12C), NRAS(p.Q61H), NRAS(p.Q61P), NRAS(p.Q61K), TERT(C228T), TERT(C250T) and ACTB gene sequence information, artificially synthesized nucleic acid fragments, and then Insert the fragment into the T vector, transform and extract the plasmid with Escherichia coli DH5α strain, measure the concentration and purity with nanodrop 2000, mix the plasmid in equal volumes and use it as the positive quality control product of the kit of the present invention.

[0109] The BRAF (p.V600E) quality control sequence is shown in SEQ ID NO.43, the HRAS (p.Q61R) quality control sequence is shown in SEQ ID NO.44, and the KRAS (p.G13D) quality control sequence is shown in SEQ ID As shown in NO.45, the KRAS (p.G13R) quality control sequence is shown in SEQ ID N...

Embodiment 3

[0111] Embodiment 3: the configuration of PCR reaction system

[0112] In the present invention, the PCR reaction liquid contains substances such as hot start taq enzyme, buffer solution, magnesium ions, dNTPs and the like required by the PCR reaction. Specifically: Tris-HCl 20mM at pH 8.3, KCl 100mM, Mg 2+ 2mM, dNTPs 0.4mM, hot start Taq DNA polymerase 0.2U / μL.

[0113] The kit of the present invention is designed with 12 PCR reaction strips. Tubes 1-11 are composed of gene detection reagents and internal control detection reagents, which respectively indicate 12 mutation sites of 5 genes of BRAF, HRAS, KRAS, NRAS and TERT. The gene detection reagents are composed of FAM signal indication, the internal control detection reagent is used to monitor the quality of sample DNA and its addition, indicated by the VIC signal; tube 12 is composed of external control detection reagents for BRAF non-mutated regions, used to quality control the quality of DNA extraction, and is also ind...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a thyroid cancer auxiliary molecule diagnosis test kit. The thyroid cancer auxiliary molecule diagnosis test kit comprises amplification primers and probes for detecting BRAF, HRAS, KRAS, NRAS and TERT genes, internal control gene ACTB primers and probes, and external control gene BRAF primers and probes; the primers are specifically used for detecting a V600E site of the BRAF gene, a Q61R site of the HRAS gene, a G12C site of the KRAS gene, a G12D site of the KRAS gene, a G13R site of the KRAS gene, a G13D site of the KRAS gene, a Q61K site of the NRAS gene, a Q61P siteof the NRAS gene, a Q61H1 site of the NRAS gene, a Q61H2 site of the NRAS gene, a C228T site of the TERT gene and a C250T site of the TERT gene. The invention also provides a use method of the thyroid cancer auxiliary molecule diagnosis test kit. The problems of sensitivity, cost, operation convenience and the like of an existing thyroid cancer auxiliary molecule diagnosis test kit are solved.

Description

technical field [0001] The invention is applied in the technical field of gene detection, and specifically relates to a thyroid cancer auxiliary molecular diagnosis kit and a use method. Background technique [0002] Thyroid nodule is a common thyroid disease, which is caused by local abnormal growth of thyroid cells. In most cases, thyroid nodules are benign and can be treated conservatively, but 5%-10% of thyroid nodules are malignant and require early surgical treatment in order to obtain a good prognosis. Fine-needle aspiration cytology (FNA) is the most reliable method for evaluating benign and malignant thyroid nodules. However, there are still 20%-30% of thyroid nodules that cannot be diagnosed as benign or malignant by FNA. Clinically, there is a lack of reliable diagnostic methods for such nodules, and most patients undergo diagnostic surgery to determine the pathology of the nodules. If the tumor is larger than 1 cm, a second operation is required to complete th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/6858
CPCC12Q1/6858C12Q1/6886C12Q2600/112C12Q2600/156C12Q2600/16C12Q2600/166C12Q2531/113C12Q2537/143C12Q2535/137
Inventor孙松松韩勋领罗锋
Owner重庆浦洛通基因医学研究院有限公司