Check patentability & draft patents in minutes with Patsnap Eureka AI!

High-wine-yield Klebsiella expressing luciferase and application thereof

A Klebsiella, luciferase gene technology, applied in the directions of enzymes, enzymes, applications, etc., can solve the problem of inability to express luciferase, and achieve the effect of simple and easy operation, high transformation efficiency, and prevention of nosocomial infection

Pending Publication Date: 2020-09-01
BEIJING DITAN HOSPITAL CAPITAL MEDICAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This plasmid can exist stably in HiAlcKpn and produce chloramphenicol resistance, but cannot express luciferase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-wine-yield Klebsiella expressing luciferase and application thereof
  • High-wine-yield Klebsiella expressing luciferase and application thereof
  • High-wine-yield Klebsiella expressing luciferase and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1 Contains the construction of the pan-host plasmid of luciferase gene

[0058] 1. LUXA / B / C / D / E gene cluster amplification:

[0059] (1), designing the primer pair of the LUX gene cluster comprising a strong promoter

[0060] LUX F:

[0061] agggaacaaaagctgggtac TTGACAGCTAGCTCAGTCCTAGGTATAATGCTAGC GCGGATAACAATTACTAGAG (SEQ ID NO.2, the underlined sequence in italics is the PJ23119 promoter sequence);

[0062] LUX R: gctgcaggaattcgatatcaATTTGTCCTACTCAGGAGAG (SEQ ID NO. 3) The sequence in bold in lower case in the primer is the complementary sequence between this sequence and pBBR1.

[0063] The lux A / B / C / D / E gene cluster in the pBBR1-LUX plasmid is operated by the T5 promoter. The experimental verification results show that the lux A / B / C / D / E gene cluster is not expressed under the T5 promoter operation, so we The PJ23119 promoter (PJ) was inserted. We used Q5 high-fidelity DNA polymerase and a primer pair containing the LUX gene cluster, and added the sa...

Embodiment 2

[0090] Example 2 Luciferase Gene Expression and Fluorescent Stability Detection in Genetically Modified Klebsiella Alcohol Producers Containing Luciferase.

[0091] 1. Preparation of high-yielding Klebsiella alcoholic bacteria electroporation competent

[0092] Pick a single colony of high-yielding Klebsiella cerevisiae and inoculate it in liquid BHI medium, and culture it overnight at 37°C. Take the overnight cultured high-yield Klebsiella alcoholic bacteria solution and inoculate it in fresh BHI medium at a ratio of 1:10, and culture it statically at 37°C until OD 600 = 0.3 to 0.4. Take out the bacterial liquid in the logarithmic phase, after 30 minutes in ice bath, centrifuge at 4°C and 4000 rcf to collect the bacterial cells, wash the bacterial cells with pre-cooled sterile double-distilled water and pre-cooled 1% sucrose solution respectively, and then the high-yielding wine grams Lebsiella competent cells.

[0093] 2. Electrotransformation of pBBR1-LUX and pBBR1-PJ-LU...

Embodiment 3

[0099] Example 3: Detection of Luciferase Intensity of Genetically Modified Klebsiella oenigenics Stably Expressing Luciferase at Different Concentrations

[0100] A single colony strain of genetically modified Klebsiella oenigenicum stably expressing luciferase was picked, cultured at 37°C for 4 hours, and the OD value of the bacteria was detected using a NanoDropTM One ultra-micro-volume ultraviolet spectrophotometer. By dilution method, adjust the concentration value OD of the strain 600 =2. OD 600 The strain of =2 was diluted 9 gradients according to 1:2, and the Luminesence value was detected on a microplate reader, and the results were as follows image 3 As shown, series 1 is: high-production Klebsiella pneumoniae of different concentrations transformed with pBBR1-LUX plasmid, series 2 is genetically modified high-production Klebsiella pneumoniae transformed with pBBR1-PJ-LUX plasmid, and the fluorescence values ​​are series logarithm of 2. The data showed that the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
electrical resistanceaaaaaaaaaa
Login to View More

Abstract

A plasmid construction technology and an electro-transformation technology are used to establish high-wine-yield Klebsiella containing a luciferase gene cluster (lux). Through auto-fluorescence identification, a subculture stability test of a strain, and observation on culture characteristics, high-wine-yield Klebsiella (HiAlc Kpn-LUX) capable of stably expressing luciferase is finally obtained. An important visual research tool is provided for researching the progress of wine-producing Klebsiella related diseases and screening proper sterilization methods and antibiotics.

Description

technical field [0001] The invention relates to the field of microbial medicine, in particular to a method for constructing a pan-hosted plasmid containing a luciferase gene and a genetically modified Klebsiella albicans stably expressing luciferase, the strain obtained by constructing the method, and the strain It is used in the evaluation method of calculating the concentration of bacteria, the screening of bactericidal methods, the screening of drugs, and the preparation of animal models of infection. Background technique [0002] Studies have shown that about 60% of non-alcoholic fatty liver disease in my country is related to high-alcohol-producing Klebsiella pneumoniae (HiAlc Kpn) in the intestinal tract of patients. HiAlc Kpn isolated from the intestines of non-alcoholic fatty liver patients was transplanted into mice, and the results showed that HiAlc Kpn could induce non-alcoholic fatty liver in mice. Feeding glucose to the above-mentioned mice colonized with HiAlc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/74C12Q1/04A61L2/10A61L2/18A23L3/28A23L3/349A23L3/358C12R1/22A61L101/20A61L101/02A61L101/34
CPCA23L3/28A23L3/349A23L3/358A23V2002/00A61L2/10A61L2/18A61L2202/24C12N9/0071C12N15/74C12Q1/04C12Y114/14003A23V2250/082
Inventor 滑明溪陈晨曾辉李昂袁静
Owner BEIJING DITAN HOSPITAL CAPITAL MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More