Antibody-drug conjugate of targeted CD45 and preparation and application thereof

An antibody drug and conjugate technology, applied in the biological field, can solve problems such as affecting the cure rate of blood system diseases, and achieve the effects of low side effects, increased scope, and reduced burden on patients

Pending Publication Date: 2020-09-04
乾元康安(苏州)生物科技有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The above-mentioned deficiencies in autologous and allogeneic bone marrow transplantation greatly affect the cure rate of hematological diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antibody-drug conjugate of targeted CD45 and preparation and application thereof
  • Antibody-drug conjugate of targeted CD45 and preparation and application thereof
  • Antibody-drug conjugate of targeted CD45 and preparation and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Construct the production vector of pTrioz-Furin-DTA-6 X His, the overall process is as attached image 3 shown.

[0058] (1) Use the pTrioz blank plasmid as a template, as attached figure 2 As shown, it contains the C region of human IgG1 light chain and the C region of human IgG1 heavy chain, using the forward primer whose sequence is shown in SEQ ID NO.4

[0059] IgHC-F-NheI- GCTAGC ACCAAGGGCCCATCGGTCTTCCCCC and the reverse primer whose sequence is shown in SEQ ID NO.5

[0060] IgHC-R-Furin-TGACAATGAGCTACCTACTGATCGCCTGACACGATTTCCTGCTTTACCCGGAGACAGGGAGAGGC was used for PCR to amplify the gene fragment IgHC with the sequence shown in SEQ ID NO.6; the underlined sequence is the restriction site.

[0061] (2) Using the pIRES-proHB EGF WT plasmid (addgene) as a template, use the forward primer whose sequence is shown in SEQ ID NO.7

[0062] DTA-F-Furin-GCAGGAAATCGTGTCAGGCGATCAGTAGGTAGCTCATTGTCAGGCGCTGATGATGTTGTTGATTC and the reverse primer DTA-R-6XHis-AvrII-CCTAGGGTG...

Embodiment 2

[0075] A commercial company synthesizes the CD45 Ab light chain with the sequence shown in SEQ ID NO.11;

[0076] Using the synthetic product as a template, using a forward primer whose sequence is shown in SEQ ID NO.12CD45 Ab-L-F-NcoI-CCATGGCAATGATGTCCTCTGCTCAG and a reverse primer whose sequence is shown in SEQ ID NO.13 CD45 Ab-L-R-BsiWI-CGTACGTTTGATTTCCAGCTTGGTGC PCR, amplifying the gene fragment CD45 Ab L whose sequence is shown in SEQ ID NO.14;

[0077] The PCR product was cloned into the vector pTrioz-Furin-DTA-6 X His using restriction sites NcoI and BsiWI to obtain the intermediate vector pTrioz-L-Furin-DTA-6 X His, as shown in SEQ ID NO.15, the construction process as attached Figure 5 shown.

[0078] The PCR reaction system is as follows:

[0079]

[0080] The PCR amplification conditions are:

[0081]

[0082] The target gene fragment CD45 L was cloned into the vector pTrioz-Furin-DTA-6 X His: After the PCR products were separated by agarose gel electroph...

Embodiment 3

[0084] Insertion of CD45 Ab heavy chain includes the following steps:

[0085] A commercial company synthesizes the CD45 Ab heavy chain with the sequence shown in SEQ ID NO.16;

[0086]Using the synthetic product as a template, using the forward primer GATATCATGAGCGTGCTGATTCTTTTGTGGC whose sequence is shown in SEQ ID NO.17 CD45 Ab-H-F-EcoRV and the reverse primer whose sequence is shown as SEQ ID NO.18 CD45 Ab-H-R-NheI-GCTAGCTACTGGTACTTCGATGTCTG PCR, amplifying the gene fragment CD45 Ab H whose sequence is shown in SEQ ID NO.19;

[0087] The PCR reaction system is as follows:

[0088]

[0089] The PCR amplification conditions are:

[0090]

[0091] The target gene fragment CD45 H was cloned into the vector pTrioz-L-Furin-DTA-6 X His: After the PCR products were separated by agarose gel electrophoresis, the target bands were excised and recovered using AxyPrep DNA Gel Extraction Kit (Axygen). Purified CD45 Ab H and carrier pTrioz-L-Furin-DTA-6 X His were digested with ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an antibody-drug conjugate of targeted CD45 and preparation and application thereof. By coupling a CD45 antibody with a drug, the targeted CD45 is used for highly selectively eliminating normal, diseased and cancerous immune cells. The antibody-drug conjugate of the targeted CD45 can be used for eliminating diseased or cancerous immune cells, replacing chemotherapeutic drugs and treating blood system diseases. The antibody-drug conjugate of the targeted CD45 only aims at the immune cells and cannot kill other active division cells, and the targeted elimination of an immune system can avoid graft-versus-host disease (GVHD), so that a large number of donor mature immune cells can be transplanted at the same time, and the immune system is quickly established.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to the construction and application of a CD45-targeting antibody drug conjugate. [0002] technical background [0003] Blood diseases include diseases that originate in the blood system and diseases that are secondary to abnormalities in the blood system caused by other diseases. In medicine, blood diseases are also a very "huge" disease. There are many types of diseases and a wide classification. Divided into four categories: hematopoietic stem cell disease, red blood cell disease, granulocytic disease and hemorrhagic disease, the first three of which can be treated by bone marrow transplantation. [0004] There are two types of bone marrow transplantation: one is allogeneic bone marrow transplantation and the other is autologous bone marrow transplantation. Allogeneic and autologous bone marrow transplantation have their own advantages and disadvantages. The biggest disa...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K47/68A61K45/00A61P35/00A61P37/06A61P31/18A61P7/00
CPCA61K47/68A61K45/00A61P35/00A61P37/06A61P31/18A61P7/00Y02A50/30
Inventor盛剑鹏
Owner乾元康安(苏州)生物科技有限公司