Supercharge Your Innovation With Domain-Expert AI Agents!

Recombinant adeno-associated virus particle and application thereof

A virus particle and virus technology, applied in the field of genetic engineering, can solve problems such as large doses

Active Publication Date: 2020-10-23
OBIO TECH SHANGHAI CORP LTD
View PDF0 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, relatively speaking, the dose of AAV6 reported in the literature is relatively large, usually (6~9)×10 9 The total amount of virus particles in vg can achieve effective fertilized egg infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adeno-associated virus particle and application thereof
  • Recombinant adeno-associated virus particle and application thereof
  • Recombinant adeno-associated virus particle and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] In this example, the inventors screened a new AAV6 mutant inserted with 7 amino acids by constructing an AAV6 peptide random mutation library.

[0050] 1. Library preparation

[0051] 1.1 Chemically synthesize the following two fragments of AAV6-7mer-NNS:

[0052] 5'cctccagagcagcagcNNSNNNSNNNSNNNSNNNSNNNSNNSacagaccctgcg3';

[0053] 5' cggtcgcagggtctgtSNNSNNNSNNNSNNNSNNNSNNSNNgctgctgctctg 3';

[0054] where NNS stands for random coding sequence.

[0055] 1.2 Add 10 μL each of the synthetic AAV6-7mer-NNS forward and reverse primers (the final concentration of the primers is 10 mM) to obtain the AAV6-7mer-NNS template by annealing. The annealing program is: 95°C, 5 min; 95°C, 1 min; 92min, 1 min; 4°C, 60 min. Among them, in the second and third steps, each cycle lowers 3° C., a total of 25 cycles.

[0056] 1.3 The plasmid pAAV-short UBC-mScarlet-polyA-P40-AAV6-Cap-FLEX-SV40 polyA (its structure and insertion site into figure 1 shown) were single-digested with BsmBI. ...

Embodiment 2

[0088] Example 2 AAV6 Mutant NS01 Construction and Virus Packaging

[0089] 1. Using the natural serotype AAV2 / 6 as a template, insert the AAV6-NS01-DNA fragment CAGACGACGGACAAGTACAAG at amino acid 588-589 to obtain the serotype vector AAV6-NS01.

[0090] 2. Use the shuttle vector pAAV-CMV-EGFP-WPRE-PolyA (for the vector map, see Figure 2A ), with AAV6-NS01 as the serotype vector packaging AAV virus.

[0091] 3. Use WPRE primers to titer the above viruses. And use test dye to confirm the normal expression of VP1, VP2, VP3.

Embodiment 3

[0092] Example 3 AAV6 mutant NS01 infects fertilized eggs

[0093] 1. Obtain fertilized eggs

[0094] The wild-type C57BL / 6J mice in this example are products of Shanghai Sipro-Bikay Experimental Animal Co., Ltd. Embryo operation solution M2 and embryo culture solution M16, cumulus cell mass digestion solution Hyaluronidase, mineral oil covered during embryo incubation is used to maintain the stability of osmotic pressure in the culture droplet, the above products are all from sigma company, the product Catalog numbers are M7167, M7292, H4272, M8410.

[0095] In order to increase the operable fertilized eggs in the experiment, the donor mice were induced to ovulate by artificial injection of hormones. PMSG (pregnant horse serum) simulates the effect of FSH (follicle stimulating hormone) to promote the growth and development of follicles, and HCG (human chorionic gonadotropin) simulates the effect of LH (luteinizing hormone) to promote ovulation. Here, the two hormones Sourc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of genetic engineering and particularly relates to a recombinant adeno-associated virus particle and application thereof. The recombinant adeno-associated virus particle comprises a mutant capsid protein AAV6, wherein compared with corresponding wild type capsid proteins AAV6, an amino acid fragment QTTDKYK is inserted into a mutant type-6 adeno-associated viruscapsid protein, i.e., the mutant capsid protein AAV6, and an insertion site is between a 588-th amino acid and a 589-th amino acid of a wild type capsid protein AAV6. The recombinant adeno-associatedvirus particle has higher infecting capability, so that an effect of infection basically the same as that of common dosage can be achieved in case of lower use dosage, and thus, injury to host cells during transduction can be effectively reduced.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a recombinant adeno-associated virus particle and its application. Background technique [0002] The use of transgenic disease models to study human diseases has a long history. Appropriate transgenic animal disease models not only provide an important basic theoretical basis for the study of disease pathogenesis, but also avoid the risks and ethical issues caused by human experiments. The construction of transgenic animal disease models has promoted human understanding and research on gene functions, and at the same time promoted the accumulation of clinical experience and the development of drugs for corresponding rare diseases. [0003] The general strategy for the construction of transgenic mice is to use CRISPR-Cas9 gene editing technology. This method is very convenient, but it relies on expensive, delicate microinjection equipment and trained and experienced operators. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/015C12N15/864C12N5/10A61K48/00
CPCA61K48/0008A61K48/005C07K14/005C12N15/86C12N2750/14122C12N2750/14123C12N2750/14144
Inventor 杨兴林贾国栋杨佳丽李琴夏清梅
Owner OBIO TECH SHANGHAI CORP LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com