Specific primer, probe and kit for gene detection of novel coronavirus

A technology for coronavirus and genetic detection, applied in the field of specific primers, probes and kits for genetic detection

Pending Publication Date: 2020-10-23
川南医学转化研究院
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to provide a specific primer, a probe and Needle...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer, probe and kit for gene detection of novel coronavirus
  • Specific primer, probe and kit for gene detection of novel coronavirus
  • Specific primer, probe and kit for gene detection of novel coronavirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] A preferred embodiment of the present invention provides a genetic detection kit for novel coronavirus, comprising:

[0076] New coronavirus-specific nucleic acid quantitative standard, that is, the partial sequence of the new coronavirus:

[0077] 5'-TTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCA CAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAA-3';

[0078] Viral RNA extraction reagent: including virus lysis system and Carrier RNA, described virus lysis system includes 4mol / L guanidine isothiocyanate, 0.5wt% sodium lauryl sarcosine, 0.1mmol / L beta mercaptoethanol, 25mmol / L Sodium citrate and 20 μg glycogen, the carrier RNA is a 200-300nt RNA mixture;

[0079] Fluorescence amplification detection reagent: mixed with one-step RT-PCR mixture, specific amplification primer and specific probe mixture; wherein,

[0080] Specific amplification primers for samples to be tested:

[0081] Primer S1: 5'-ACGCGTTCCATGTGGTCAT-3',

[0082] Primer R1: 5'-CATGGAGTGGCA...

Embodiment 2

[0097] A preferred embodiment of the present invention provides a genetic detection kit for novel coronavirus, comprising:

[0098] New coronavirus-specific nucleic acid quantitative standard, that is, the partial sequence of the new coronavirus:

[0099] 5'-TTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCA CAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAA-3';

[0100] Viral RNA extraction reagent: including virus lysis system and Carrier RNA, described virus lysis system includes 5mol / L guanidine isothiocyanate, 0.4wt% sodium lauryl sarcosine, 0.08mmol / L beta mercaptoethanol, 23mmol / L Sodium citrate and 19 μg glycogen, the carrier RNA is a 200-300nt RNA mixture;

[0101] Fluorescence amplification detection reagent: mixed with one-step RT-PCR mixture, specific amplification primer and specific probe mixture; wherein,

[0102] Specific amplification primers:

[0103] Primer S2: 5'-GGACGCTGTGACATCAAGGA-3',

[0104] Primer R2: 5'-AGCGTTCGTGATGTAGCAAC-3';

[0105] ...

Embodiment 3

[0119] Utilize the method that the kit of embodiment 1 detects, specifically as follows:

[0120] Viral RNA was extracted from the cell-free body fluids of 20 subjects by using the viral RNA extraction reagent:

[0121] In 200ul RNase free H 2Add 600ul guanidine isothiocyanate to O, then add control and sample respectively, add 200ul chloroform, invert and mix well, centrifuge at 13000rpm for 15min to get the supernatant; then add 400ul pre-cooled isopropanol, invert and mix well, Centrifuge for 15 minutes, then add 600ul of 75% ethanol, mix upside down, centrifuge at 13000rpm for 15min, discard the supernatant; then centrifuge at 4000rpm for 10sec, and dry at room temperature for 2-3min; finally add 20ul of DEPE water, mix gently to dissolve the RNA; After centrifugation at 2000 rpm for 5 sec, it was stored on ice.

[0122] Use the new coronavirus-specific nucleic acid quantitative standard as the positive control, that is, the partial sequence of the new coronavirus:

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a specific primer, a probe and a kit for gene detection of a novel coronavirus. The kit comprises a novel coronavirus specific nucleic acid quantitative standard substance, a virus RNA extraction reagent and a fluorescence amplification detection reagent. In detection, plasma, whole blood, throat swab, mouthwash or respiratory tract secretion of an object to be detected isdirectly used as an analysis sample, RNA in the sample is extracted as a nucleic acid template, and fluorescence polymerase chain reaction amplification is carried out on a nucleic acid template chain. The detection method is quick and convenient, can detect whether the secreta or blood of the to-be-detected object has the novel coronavirus as soon as possible, and effectively reduces the propagation of the novel coronavirus in people.

Description

technical field [0001] The invention belongs to the technical field of genetic detection kits, in particular to a specific primer, probe and kit for genetic detection of novel coronavirus. Background technique [0002] The new coronavirus belongs to the new coronavirus of the genus β, which has an envelope, and the particles are round or oval, often pleomorphic, with a diameter of 60-140nm. Its genetic characteristics are significantly different from those of SARSr-CoV and MERSr-CoV. The source of infection seen so far is mainly patients infected with the new coronavirus. Asymptomatic infected persons may also become a source of infection. Respiratory droplet and contact transmission are the main routes of transmission. Based on the current epidemiological survey, the incubation period is 1-14 days, mostly 3-7 days, with fever, fatigue, and dry cough as the main manifestations. Due to its long incubation period, patients still have the ability to spread during the incuba...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11C12R1/93
CPCC12Q1/701C12Q1/6851C12Q2531/113C12Q2545/113C12Q2563/107
Inventor 肖占刚杜富宽赵曰水吴旭
Owner 川南医学转化研究院
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap