Specific primer, probe and kit for gene detection of novel coronavirus
A technology for coronavirus and genetic detection, applied in the field of specific primers, probes and kits for genetic detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0075] A preferred embodiment of the present invention provides a genetic detection kit for novel coronavirus, comprising:
[0076] New coronavirus-specific nucleic acid quantitative standard, that is, the partial sequence of the new coronavirus:
[0077] 5'-TTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCA CAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAA-3';
[0078] Viral RNA extraction reagent: including virus lysis system and Carrier RNA, described virus lysis system includes 4mol / L guanidine isothiocyanate, 0.5wt% sodium lauryl sarcosine, 0.1mmol / L beta mercaptoethanol, 25mmol / L Sodium citrate and 20 μg glycogen, the carrier RNA is a 200-300nt RNA mixture;
[0079] Fluorescence amplification detection reagent: mixed with one-step RT-PCR mixture, specific amplification primer and specific probe mixture; wherein,
[0080] Specific amplification primers for samples to be tested:
[0081] Primer S1: 5'-ACGCGTTCCATGTGGTCAT-3',
[0082] Primer R1: 5'-CATGGAGTGGCA...
Embodiment 2
[0097] A preferred embodiment of the present invention provides a genetic detection kit for novel coronavirus, comprising:
[0098] New coronavirus-specific nucleic acid quantitative standard, that is, the partial sequence of the new coronavirus:
[0099] 5'-TTGAGTGAAATGGTCATGTGTGGCGGTTCACTATATGTTAAACCAGGTGGAACCTCATCAGGAGATGCCA CAACTGCTTATGCTAATAGTGTTTTTAACATTTGTCAA-3';
[0100] Viral RNA extraction reagent: including virus lysis system and Carrier RNA, described virus lysis system includes 5mol / L guanidine isothiocyanate, 0.4wt% sodium lauryl sarcosine, 0.08mmol / L beta mercaptoethanol, 23mmol / L Sodium citrate and 19 μg glycogen, the carrier RNA is a 200-300nt RNA mixture;
[0101] Fluorescence amplification detection reagent: mixed with one-step RT-PCR mixture, specific amplification primer and specific probe mixture; wherein,
[0102] Specific amplification primers:
[0103] Primer S2: 5'-GGACGCTGTGACATCAAGGA-3',
[0104] Primer R2: 5'-AGCGTTCGTGATGTAGCAAC-3';
[0105] ...
Embodiment 3
[0119] Utilize the method that the kit of embodiment 1 detects, specifically as follows:
[0120] Viral RNA was extracted from the cell-free body fluids of 20 subjects by using the viral RNA extraction reagent:
[0121] In 200ul RNase free H 2Add 600ul guanidine isothiocyanate to O, then add control and sample respectively, add 200ul chloroform, invert and mix well, centrifuge at 13000rpm for 15min to get the supernatant; then add 400ul pre-cooled isopropanol, invert and mix well, Centrifuge for 15 minutes, then add 600ul of 75% ethanol, mix upside down, centrifuge at 13000rpm for 15min, discard the supernatant; then centrifuge at 4000rpm for 10sec, and dry at room temperature for 2-3min; finally add 20ul of DEPE water, mix gently to dissolve the RNA; After centrifugation at 2000 rpm for 5 sec, it was stored on ice.
[0122] Use the new coronavirus-specific nucleic acid quantitative standard as the positive control, that is, the partial sequence of the new coronavirus:
[0...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



