Unlock instant, AI-driven research and patent intelligence for your innovation.

Multifunctional nucleic acid nano assembly and preparation method thereof

A nucleic acid nanometer and functional nucleic acid technology, applied in the field of biomedicine, can solve the problems of limiting the application of nucleic acid drugs, high toxicity of thiol monomers, poor application effect, etc., and achieve the effects of high loading efficiency, high stability and improved stability.

Inactive Publication Date: 2020-11-17
FUZHOU UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the thiol monomer is too toxic and the in vivo application effect is poor
It has been reported (A BiomimeticCoordination Nanoplatform for Controlled Encapsulation and Delivery of Drug–Gene Combinations) to assemble nanoparticles using Fe2+ and nucleic acid, but its stability is too poor, and it degrades within 10 minutes in PBS
[0005] Based on the technical problems of the current preparation methods of nucleic acid drugs, such as single method, specific method, low load rate and poor stability, the application of nucleic acid drugs is severely limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multifunctional nucleic acid nano assembly and preparation method thereof
  • Multifunctional nucleic acid nano assembly and preparation method thereof
  • Multifunctional nucleic acid nano assembly and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Raw sequence: ATCCATCCCGACCTCATCCATCCCCGACCTC;

[0052] F modified sequence (FNA): / i2FA / TCCATCCCGACCTCATCCATCCCCGACCTC.

[0053] FNA was purchased from Shanghai Sangong.

Embodiment 2

[0054] Example 2 Preparation of DOX-FNA

[0055] The preparation method of nucleic acid drug DOX-FNA in the present embodiment is as follows:

[0056] (1) Add 527 μL of sterile water to 10OD of FNA, avoid light, and pipette at room temperature to disperse the nucleic acid evenly, form a 100 μM stock solution, and store at -20°C in the dark.

[0057] (2) Disperse 57.9 mg of doxorubicin hydrochloride (DOX) in 10 mL of secondary water at room temperature and avoid light to obtain a 10 mM doxorubicin hydrochloride stock solution, which is stored in the dark.

[0058] (3) Mix 5 μL of FNA, 5 μL of DOX and 20 μL of secondary water thoroughly, then place in a metal bath, react at 95° C. for 10 min, and cool to room temperature.

[0059] (4) The sample was taken out, centrifuged at 8000 rpm for 5 min, and washed twice with water.

[0060] figure 2 Transmission electron microscope (a), scanning electron microscope (b), potential change (c) and particle size distribution (d) of the n...

Embodiment 3

[0061] Example 3 Fe 2+ - Preparation of FNA

[0062] (1) Mix 12 μL of 100 μM FNA, 2 μL of 20 mM FeCl 2 Mix well with 26μL of secondary water, then place in a metal bath, react at 95°C for 10min, and cool to room temperature.

[0063] (2) The sample was taken out, centrifuged at 8000rpm for 5min, and washed twice with water. get Fe 2+ - FNA nanospheres.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to the field of biological medicines, in particular to a multifunctional nucleic acid nano assembly and a preparation method thereof. The preparation method comprises the following steps of taking fluorine-modified functional nucleic acid and functional molecules as raw materials, and performing self-assembly in an aqueous solution to form the multifunctional nucleic acid nano assembly. According to the multifunctional nucleic acid nano assembly and the preparation method thereof, due to the specificity of fluorine atoms, the active site and the space structure of the nucleic acid structure are changed, so that the fluorine-modified nucleic acid and various types of molecules can directly assemble to form a series of nano-structures, the method is simple, raw materials are easy to obtain, wide universality is achieved, the obtained nanostructure has higher stability and loading efficiency, and as a universal method, the invention provides a better reference for the preparation and development of novel nucleic acid medicines.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a multifunctional nucleic acid nano assembly and a preparation method thereof. Background technique [0002] Nucleic acid drugs, also known as nucleotide drugs, are various oligoribonucleotides (RNA) or oligodeoxyribonucleotides (DNA) with different functions, mainly at the gene level. It is generally believed that nucleic acid drugs include Aptamer, Antigene, Ribozyme, Antisense Nucleic acid, and RNA interference agents. Because they are specific for disease-causing genes, that is to say, have specific targets and mechanisms of action, nucleic acid drugs, especially small nucleic acid drugs, show excellent application prospects in the fields of biological diagnosis and treatment. The synergistic use of functional nucleic acids and functional small molecules, especially some chemotherapeutic drugs, is becoming an important clinical research direction at present. [0003] However, bec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K9/14A61K47/26A61K31/7088B82Y5/00
CPCA61K9/145A61K31/7088B82Y5/00A61K31/713A61K45/06A61K31/704A61K2300/00
Inventor 卢春华王海辉祝筱慧刘永飞杨黄浩
Owner FUZHOU UNIV