Method for preparing chiral duloxetine intermediate by aldehyde ketone reductase and asymmetric reduction

A technology of duloxetine and reductase, which is applied in the field of preparation of chiral duloxetine intermediates by aldehyde and ketone reductase and asymmetric reduction, which can solve the problems of low substrate tolerance, limited industrial application, long reaction time, etc. problems, to achieve the effect of convenient operation, simple equipment and high yield

Pending Publication Date: 2020-11-24
HUAQIAO UNIVERSITY
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, since whole cells limit the interaction between enzyme and substrate, the reaction time is long and the substrate tolerance is low, which greatly limits its industrial application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing chiral duloxetine intermediate by aldehyde ketone reductase and asymmetric reduction
  • Method for preparing chiral duloxetine intermediate by aldehyde ketone reductase and asymmetric reduction

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] (1) Preparation of recombinant engineered bacteria:

[0035] The DNA of Bacillus megaterium BM1-1 was extracted, and the kit used to extract the DNA was Ezup Column Bacteria Genomic DNA Extraction Kit.

[0036] DNA amplification was performed using the extracted Bacillus megaterium BM1-1 genome as a template to obtain the aldehyde and ketone reductase gene sequence shown in Appendix 1. The PCR reaction system is: 13 μL H 2 O, 1 μL upstream primer (primer sequence is F1: 5'GGAATTCCATATGATGCAATATCGAAAGCTTGGAAC3'), 1 μL downstream primer (primer sequence is R1: 5'CCGCTCGAGTTAATACAGTGAATTCACGGTATTC3'), 1 μL total DNA, 4 μL PrimeSTAR MaxPremix; PCR reaction conditions: 94 ° C pre-denaturation for 5 min , denatured at 94°C for 10s, annealed at 54°C for 10s, extended at 72°C for 6s, cycled 30 times, and extended at 72°C for 10 minutes; double-enzyme cut the aldoketone reductase gene and pET28a plasmid with NdeI and XhoI respectively, and ligated them with T4 DNA ligase Esche...

Embodiment 2

[0041] Step (1) to step (2) are the same as embodiment 1, and step (3) is as follows

[0042] (3) Enzyme-catalyzed reaction: 5 mg of DKTP was dissolved in 5 mL of AKR3-2-9 enzyme solution, and NADPH was added (final concentration: 0.5 mM). Then, it was placed at 37° C. and reacted in a shaker at 200 r / min for 24 hours.

[0043] (4) Analysis and detection: analysis and detection: the concentration and enantiomeric excess value of the product S-DHTP are determined by high performance liquid chromatography. After the reaction was completed, the reacted sample was centrifuged at 4° C. and 10,000 r / min for 10 min, and the supernatant was taken. The enzyme catalyzes the substrate DKTP, and the product is quantitatively analyzed by high performance liquid chromatography. The yield of S-DHTP was 31%, and the optical purity was greater than 92%.

Embodiment 3

[0045] Step (1) to step (2) are the same as embodiment 1, and step (3) is as follows

[0046] (3) Enzyme-catalyzed reaction: 10 mg of DKTP was dissolved in 5 mL of AKR3-2-9 enzyme solution, and NADPH was added (final concentration: 0.5 mM). Then, it was placed at 37° C. and reacted in a shaker at 200 r / min for 24 hours.

[0047] (4) Analysis and detection: analysis and detection: the concentration and enantiomeric excess value of the product S-DHTP are determined by high performance liquid chromatography. After the reaction was completed, the reacted sample was centrifuged at 4° C. and 10,000 r / min for 10 min, and the supernatant was taken. The enzyme catalyzes the substrate DKTP, and the product is quantitatively analyzed by high performance liquid chromatography. The yield of S-DHTP was 13%, and the optical purity was greater than 92%.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for preparing chiral duloxetine intermediate by aldehyde ketone reductase and asymmetric reduction, and belongs to the technical field of asymmetric synthesis of chiral compounds by biological method. The aldehyde ketone reductase obtained by the invention comes from Bacillus megaterium BM1-1. Through strain culture, gene cloning, engineering bacterium construction, aldehyde ketone reductase expression and purification, with the addition of NADPH and auxiliary substrates, aldehyde ketone reductase catalyzes the substrate 3-(dimethylamino)-1-(2-thienyl)-1-acetone(DKTP) to produce (S)-3-(dimethylamino)-1-(2-thienyl)-1-propanol(S-DHTP). According to the present invention, the reaction system and reaction conditions based on the catalyzed asymmetric reduction of DKTP. The method of the invention has convenient operation and simple equipment, has good industrial application prospects in the field of biocatalytic preparation of chiral duloxetine intermediates, and has important significance for the development of special enzyme sources for biocatalysis and the research of chiral compound synthesis methods in the future.

Description

technical field [0001] The invention relates to the stereoselective preparation of (S)-3-(dimethylamino)-1-( 2-thienyl)-1-propanol method. Background technique [0002] In nature, there is an extremely important symmetrical structure, which means that an object does not coincide with its mirror image, just like the left hand and right hand of a human being. This structure is called chiral structure. In stereochemistry, the study of chiral compounds has attracted more and more attention. Among many chiral compounds, chiral alcohols are special. There are active hydroxyl functional groups attached to the chiral carbon atoms. Based on this structure, they can be replaced by other functional groups, thereby deriving various other optically active compounds, such as Aromatic alcohols, o-diols, etc. Chiral alcohols and their derivatives are important intermediates in the synthesis of many chiral drugs, so they are of great value in the field of medicine. [0003] (S)-3-(Dimeth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12P17/00
CPCC12N9/0006C12N15/70C12P17/00
Inventor江伟裴蕊周树锋
OwnerHUAQIAO UNIVERSITY