Application of DRK protein and coding gene thereof in drought resistance of plants

A technology that encodes genes and proteins, applied in applications, plant products, genetic engineering, etc., can solve the problems of less functional research and achieve the effects of short breeding time, enhanced plant drought resistance, and improved efficiency

Active Publication Date: 2020-11-27
CHINA AGRI UNIV
View PDF1 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In summary, there have been some studies on RAF-like MAPKKK proteins in plants, but they are mainly concentrated in the dicotyledon Arabidopsis thaliana, and there are relatively few functional studies and reports on this type of gene in maize, especially this type of protein kinase The role in maize drought-response signaling remains to be further studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of DRK protein and coding gene thereof in drought resistance of plants
  • Application of DRK protein and coding gene thereof in drought resistance of plants
  • Application of DRK protein and coding gene thereof in drought resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1, Construction and Detection of CRISPR / Cas9 Gene Editing Vectors

[0042] In order to study the molecular mechanism of RAF-like MAPKKK family proteins in plant drought resistance, the present invention uses CRISPR / Cas9 technology to directionally mutate the DRK gene (nucleotide sequence shown in SEQ ID NO.1) from the genome of maize (Zea mays L.) , the amino acid sequence is shown in SEQ ID NO.2). First log in to the website http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html to screen the target. sequence such as figure 1 shown in figure 1 Among them, the T01 transcript is from the 1112th to the 2609th base of the 5' end, the capital letters are bolded as exons, the start codon and stop codon are in the gray box, and the underlined part is the target.

[0043] The primers used are as follows:

[0044] ID-If: GGCGCGTCATGCCCTGGAACGGG (SEQ ID NO. 3);

[0045] ID-1r: AAACCCCGTTCCAGGGCATGACG (SEQ ID NO. 4).

[0046] Carrier construction method:

[0047] (...

Embodiment 2

[0059] Example 2, Construction and Identification of DRK Gene CRISPR-Cas9 Plants

[0060] The plasmid with correct sequencing constructed in Example 1 was transformed into competent Agrobacterium strain EHA105 by heat shock method, and positive clones were identified by colony PCR. Inoculate a single colony of Agrobacterium correctly identified in 2-3 mL of liquid medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, culture with shaking at 28 °C overnight, and transfer a large amount of liquid containing antibiotics the next day Shake culture in the medium, collect the cells after several transfers, and resuspend to OD 600 Between 0.8-1.0. After the obtained recombinant Agrobacterium suspension was used to infect the B73 maize immature embryos picked out under aseptic conditions, callus was induced to form seedlings. Sequencing found that the single base deletion mutation in this example caused a frameshift ( figure 2 ), leading to premature termination of protei...

Embodiment 3

[0061] Example 3, DRK mutant corn drought treatment phenotype detection

[0062] Add 140g of soil to each small pot, add water to the tray, put 4 seeds in each small pot, cover 50cm 3 After the soil is full of water, pour out the remaining water in the tray. After emergence, remove a seedling with uneven growth, add 1L of water in the tray, pour out the water after it is full, start the drought treatment, and observe the control and mutation Somatic plant phenotypes under drought treatment. The control and mutant plants were replicated in 3 pots each. image 3 It shows that the growth condition of DRK CRISPR / Cas9 mutant plants is better than that of the control, and the wilting degree of leaves is lower than that of the control, indicating that the mutant plants are more drought-resistant than the control.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of plant genetic engineering, and particularly relates to application of DRK protein and a coding gene thereof in drought resistance of plants. After expression of the DRK gene is inhibited, the growth of mutant plants under the drought treatment condition is obviously superior to that of wild plants, and the water loss rate and the leaf wilting degreeare obviously lower than those of the wild plants, so that the drought resistance of the plants can be remarkably enhanced by inhibiting the function of the gene, gene resources are provided for cultivating and improving new varieties of drought-resistant plants, and a theoretical basis is provided for clarifying the molecular mechanism of MAPKKK protein kinase in plant drought stress signal response.

Description

technical field [0001] The invention relates to the technical field of plant genetic engineering, in particular to the application of DRK protein and its coding gene in plant drought resistance. Background technique [0002] Corn is one of the three major food crops in the world and is planted in a wide range of areas. Different climatic conditions such as temperature, humidity, and wind in different regions will affect the planting and yield of corn, among which drought is one of the most important factors affecting corn yield. When maize seedlings are under drought stress, growth and development will be inhibited, resulting in shorter plant height, wilting leaves, and reduced photosynthesis. Drought during the grain-filling stage of corn can lead to underfilled kernels and reduced yields. Therefore, improving the drought resistance of maize is very important for maize yield. Through genetic engineering, the use of gene overexpression and mutation to breed new drought-re...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/12C12N15/8218C12N15/8273C12Y207/11025
Inventor巩志忠王瑜孙志慧
OwnerCHINA AGRI UNIV