Application of Map2k3 or Map2k6 in improvement of efficiency of inducing adult cells to generate pluripotent stem cells
A pluripotent stem cell and cell generation technology, applied in the field of improving the efficiency of inducing adult cells to generate pluripotent stem cells, can solve the problems of carcinogenicity, low induction efficiency, gene insertion mutation, etc. The effect of improving quality
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] 1. construction of vector containing Map2k3 or Map2k6 coding region:
[0052] A. design of clone primers
[0053] from https: / / www.ncbi.nlm.nih.gov / Acquiring the sequence information of the cDNA of Map2k3 or Map2k6. The Map2k3 and Map2k6 sequences are seq id no: 1 and seq id no: 2, respectively, and the coding sequences of Map2k3 or Map2k6 are amplified by designing specific primers.
[0054] The upstream primer base sequence of Map2k3 is shown in seq id no: 3, and the downstream primer is shown in seq id no: 4.
[0055] ACCATGGAGTCGCCCGCCGCGAG(SEQ ID NO:3)
[0056] CTATGAATCCTCTCCCAGGATCTCC(SEQ ID NO:4)
[0057] The upstream primer base sequence of the coding sequence of Map2k6 is shown in seq id no: 5, and the downstream primer is shown in seq id no: 6.
[0058] ACCATGTCTCAGTCGAAAGGCAAGAAGC(SEQ ID NO:5)
[0059] TTAGTCCCCAAGTATCAGTTTTACAAAAGA(SEQ ID NO:6)
[0060] B, amplifying the coding sequence by RT-PCR
[0061] Total mRNA was extracted from the isolated embryonic fi...
Embodiment 1
[0085] Identification of induced pluripotent stem cells obtained in Example 1:
[0086] such as 图2 As shown in, a series of identification experiments were conducted on transcription factors and pluripotent stem cell clones induced by Map2k3 or Map2k6 to prove whether they are iPS cells (induced pluripotent stem cells). Identification experiments included: PCR, quantitative PCR, karyotype identification, chimera formation, etc.
[0087] 1、PCR
[0088] All PCR experiments were carried out with the kit of Takara Company on Life ECO PCR instrument of Bori Company, and the reaction condition was 95℃ for 5 minutes. Repeat for 40 cycles at 90℃ for 30 seconds, 60℃ for 30 seconds, and 72℃ for 60 seconds, and take the amplified product for agarose gel electrophoresis.
[0089] 2. Quantitative PCR experiment
[0090]All quantitative PCR experiments were carried out with the kit of Takara Company on the CFX-96 quantitative PCR instrument of Biorad Company, and the reaction condition was 95℃ ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


