Check patentability & draft patents in minutes with Patsnap Eureka AI!

Application of Map2k3 or Map2k6 in improvement of efficiency of inducing adult cells to generate pluripotent stem cells

A pluripotent stem cell and cell generation technology, applied in the field of improving the efficiency of inducing adult cells to generate pluripotent stem cells, can solve the problems of carcinogenicity, low induction efficiency, gene insertion mutation, etc. The effect of improving quality

Pending Publication Date: 2020-12-11
GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
View PDF1 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In the process of inducing iPS, exogenous genes are often introduced into cells by means of retroviruses and lentiviruses. In this way, high gene transduction efficiency can be obtained, but the integration of viral sequences into the genome of cells will lead to gene insertion mutations. , even carcinogenic, so this potentially dangerous gene transfer method is obviously not conducive to the application of iPS technology in the field of regenerative medicine. Therefore, different research groups have used non-integrating vectors to induce iPS and achieved success. These vectors include Adenoviral vectors, general expression vectors, transposons, episomal vectors, minicircle DNA (minicircleDNA) vectors
[0005] At present, the combinations of transcription factors capable of reprogramming include Oct4, Klf4, Sox2, c-Myc; Oct4, Nanog, Lin28, Sox2; Sox2, Klf4, and Lrh1; Related genes, the combination of transcription factors required by the existing reprogramming method needs to import more transcription factors, and the induction efficiency is low. It is of great significance to study the mechanism of reprogramming and the improvement of reprogramming technology by screening highly efficient non-integrating vectors and compounds that replace transcription factors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of Map2k3 or Map2k6 in improvement of efficiency of inducing adult cells to generate pluripotent stem cells
  • Application of Map2k3 or Map2k6 in improvement of efficiency of inducing adult cells to generate pluripotent stem cells
  • Application of Map2k3 or Map2k6 in improvement of efficiency of inducing adult cells to generate pluripotent stem cells

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] 1. construction of vector containing Map2k3 or Map2k6 coding region:

[0052] A. design of clone primers

[0053] from https: / / www.ncbi.nlm.nih.gov / Acquiring the sequence information of the cDNA of Map2k3 or Map2k6. The Map2k3 and Map2k6 sequences are seq id no: 1 and seq id no: 2, respectively, and the coding sequences of Map2k3 or Map2k6 are amplified by designing specific primers.

[0054] The upstream primer base sequence of Map2k3 is shown in seq id no: 3, and the downstream primer is shown in seq id no: 4.

[0055] ACCATGGAGTCGCCCGCCGCGAG(SEQ ID NO:3)

[0056] CTATGAATCCTCTCCCAGGATCTCC(SEQ ID NO:4)

[0057] The upstream primer base sequence of the coding sequence of Map2k6 is shown in seq id no: 5, and the downstream primer is shown in seq id no: 6.

[0058] ACCATGTCTCAGTCGAAAGGCAAGAAGC(SEQ ID NO:5)

[0059] TTAGTCCCCAAGTATCAGTTTTACAAAAGA(SEQ ID NO:6)

[0060] B, amplifying the coding sequence by RT-PCR

[0061] Total mRNA was extracted from the isolated embryonic fi...

Embodiment 1

[0085] Identification of induced pluripotent stem cells obtained in Example 1:

[0086] such as 图2 As shown in, a series of identification experiments were conducted on transcription factors and pluripotent stem cell clones induced by Map2k3 or Map2k6 to prove whether they are iPS cells (induced pluripotent stem cells). Identification experiments included: PCR, quantitative PCR, karyotype identification, chimera formation, etc.

[0087] 1、PCR

[0088] All PCR experiments were carried out with the kit of Takara Company on Life ECO PCR instrument of Bori Company, and the reaction condition was 95℃ for 5 minutes. Repeat for 40 cycles at 90℃ for 30 seconds, 60℃ for 30 seconds, and 72℃ for 60 seconds, and take the amplified product for agarose gel electrophoresis.

[0089] 2. Quantitative PCR experiment

[0090]All quantitative PCR experiments were carried out with the kit of Takara Company on the CFX-96 quantitative PCR instrument of Biorad Company, and the reaction condition was 95℃ ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides application of Map2k3 or Map2k6 in improvement of the efficiency of inducing adult cells to generate pluripotent stem cells, a method for improving the efficiency of inducing the adult cells to generate the pluripotent stem cells and a kit. The method comprises the following step: introducing Map2k3 or Map2k6 and transcription factors into mammalian adult cells for induced culture to obtain the pluripotent stem cells, wherein the stem cell induction factors are Oct4, Klf4 and Sox2, or Oct4, Klf4, Sox2 and c-Myc. The method further comprises the step of adding vitamin C into an induction medium, and the efficiency of inducing the pluripotent stem cells is further improved compared with the method without adding the vitamin C. According to the application, the efficiency of inducing the pluripotent stem cells is improved by adopting the kinase gene Map2k3 or Map2k6 and the transcription factors, so that the high-quality induced pluripotent stem cells with reproductive system transmission capacity are obtained.

Description

Technical field [0001] The invention relates to the field of biology. Particularly, the invention relates to the application of Map2k3 or Map2k6 in improving the efficiency of inducing adult cells to generate pluripotent stem cells. technical background [0002] Human embryonic stem cells (hESCs) are a kind of totipotent stem cells, which have the potential of infinite proliferation, self-renewal and multi-directional differentiation in vitro. Theoretically, whether in vitro or in vivo, hESCs can be induced to differentiate into almost all cell types of human body. Further research and application of hESCs will open up a new way for transplantation therapy and treatment of macular degeneration, Parkinson's disease, amyotrophic lateral sclerosis and other difficult diseases. However, because hESCs are difficult to obtain and involve sensitive ethical issues, the clinical research of hESCs was once in an awkward position and could not be carried out on a large scale. [0003] In 20...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10C12N5/074
CPCC12N15/86C12N5/0656C12N5/0696C12N2740/10043C12N2800/107C12N2510/00C12N2501/727C12N2501/603C12N2501/602C12N2501/604C12N2501/606C12N2500/32C12N2500/38C12N2500/44C12N2500/30C12N2501/235C12N2506/1307
Inventor 裴端卿王涛黄璐圆陈可实朱洁滢刘兴国曾小明杨建国赵丹芸
Owner GUANGZHOU INST OF BIOMEDICINE & HEALTH CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More