Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Rainbow trout atg12 gene and rainbow trout ATG12 protein

An ATG12, gene technology, applied in genetic engineering, plant genetic improvement, from serum immunoglobulins, etc., can solve problems such as non-specific identification

Inactive Publication Date: 2021-01-15
HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the current commercial antibodies cannot specifically recognize the ATG12 protein of rainbow trout

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rainbow trout atg12 gene and rainbow trout ATG12 protein
  • Rainbow trout atg12 gene and rainbow trout ATG12 protein
  • Rainbow trout atg12 gene and rainbow trout ATG12 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Cloning of CDS region of rainbow trout autophagy gene atg12:

[0025] 1. Primer design: The primer sequence is F: GACACACTCATGATAAGGACTGCTG,

[0026] R: ACATTGGTTTAGGCAAGGAAGG;

[0027] 2. Extraction of total RNA in rainbow trout tissue: Trizol was used to extract total RNA in rainbow trout liver tissue;

[0028] 3. Reverse RNA to cDNA: For the operation steps, refer to the reverse ABI kit K1622 RevertAidTM FirstStrand cDNA Synthesis Kit;

[0029] 4. RT-PCR amplification reaction;

[0030] 5. Gel recovery of PCR reaction products to obtain purified rainbow trout autophagy gene atg12.

[0031] The nucleotide sequence of the rainbow trout atg12 gene in this embodiment is shown in the nucleotide sequence of SEQ ID NO:1 after sequencing.

Embodiment 2

[0033] The RNA extraction method in step 2 of embodiment 1 is as follows:

[0034] (1) Homogenization treatment: Grind the liver tissue in liquid nitrogen, add 1 mL Trizol per 100 mg and shake repeatedly, the sample volume does not exceed 10% of the Trizol volume;

[0035] (2) Place the homogenized sample at room temperature for 10 minutes to completely separate the nucleic acid and protein complexes;

[0036] (3) Centrifuge at 4°C and 10000g for 10 minutes, take the supernatant and add it to a new EP tube;

[0037] (4) Add 200 μL of chloroform to the supernatant, shake vigorously for 30 seconds, and place on ice for 5 minutes;

[0038] (5) Centrifuge at 4°C and 10,000g for 15 minutes, then transfer the supernatant aqueous phase to a new EP tube;

[0039] (6) Add 500 μL of isopropanol to the supernatant aqueous phase liquid, and place on ice for 10 minutes;

[0040] (7) Centrifuge at 4°C and 10,000g for 10 minutes, and a white precipitate will appear at the bottom of the EP...

Embodiment 3

[0045] Inversion system and PCR reverse transcription program in Step 3 of Example 1

[0046] The reverse system is:

[0047]

[0048]

[0049] The PCR reverse transcription program is:

[0050] 25°C 10min

[0051] 37℃ 120min

[0052] 85℃ 5min

[0053] After inversion, the cDNA was divided into aliquots and stored at -20°C, and repeated freezing and thawing should be avoided as much as possible.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a rainbow trout atg12 gene and a rainbow trout ATG12 protein, and relates to rainbow trout genes and rainbow trout proteins. The invention provides a rainbow trout atg12 gene sequence, a rainbow trout ATG12 protein and a preparation method of a rainbow trout ATG12 protein polyclonal antibody. The rainbow trout ATG12 protein of the invention is obtained through prokaryotic expression, and a material basis is laid for studying mechanisms associated with autophagy proteins of rainbow trout. Due to lack of effective commercial antibodies in cold water fishes, studies on growth and development mechanisms of the cold water fishes are limited at transcriptional and post-transcriptional levels. At present, the studies about mechanisms of protein level in the cold water fishes are in a blank stage. The polyclonal antibody against the autophagy protein (ATG12 protein) of the rainbow trout can efficiently and specifically detect the expression of the autophagy protein of the rainbow trout, and lays a material basis for studying mechanisms associated with autophagy proteins of rainbow trout.

Description

technical field [0001] The invention relates to a rainbow trout gene and a rainbow trout protein. Background technique [0002] Rainbow trout (Onchorynchus mykiss), as an economic fish that was cultured early in the world, began to be cultured in my country in the late 1950s. At present, the breeding technology and scale of rainbow trout in my country are very mature, and have been successfully promoted in more than 20 regions across the country. As a typical carnivorous cold-water fish, rainbow trout has the characteristics of fast growth, good meat quality, delicious flavor, easy to raise and catch, and high feed utilization rate. As one of the three high-quality and high-yield freshwater farmed fish promoted by the Food and Agriculture Organization of the United Nations, it is also regarded as a rare species internationally. Autophagy is a ubiquitous phenomenon in eukaryotic cells, and it plays a special role in maintaining the homeostasis of the cell environment and ce...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/46C12N15/12C12N15/70C12N15/66C07K16/18C07K16/06
CPCC07K14/461C07K16/06C07K16/18C12N15/66C12N15/70
Inventor 黄天晴刘恩慧谷伟徐革锋王炳谦史秀兰
Owner HEILONGJIANG RIVER FISHERY RES INST CHINESE ACADEMY OF FISHERIES SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com