Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Maize leaf zebra stripe leaf color gene zb9, InDel molecular marker linked with maize leaf zebra stripe leaf color gene zb9 and application

A molecular marker, leaf zebra technology, applied in the field of molecular genetics, to achieve the effects of reliable detection results, improved identification efficiency, and high application value

Pending Publication Date: 2021-02-02
SICHUAN AGRI UNIV
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although many leaf color-related genes have been cloned, the biosynthesis and development of plant chloroplasts is an extremely complex process, which is jointly regulated by nuclear genes and its own plastid genome. There is a long way to go to study the regulation mechanism

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maize leaf zebra stripe leaf color gene zb9, InDel molecular marker linked with maize leaf zebra stripe leaf color gene zb9 and application
  • Maize leaf zebra stripe leaf color gene zb9, InDel molecular marker linked with maize leaf zebra stripe leaf color gene zb9 and application
  • Maize leaf zebra stripe leaf color gene zb9, InDel molecular marker linked with maize leaf zebra stripe leaf color gene zb9 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Map-based cloning of the zebra-striped mutant gene zb9 in maize leaves

[0035] 1. The zebra-striped mutant of corn leaves used in this experiment was obtained from the Maize Research Institute of Sichuan Agricultural University. figure 1 ), compared with the wild type, the mutant zb9 plants were slightly shorter, and the leaves showed a zebra-striped phenotype. figure 1 Among them, (a) is the whole plant of corn at the silking stage, and the scale is 20cm; (b) is the corn leaf at the four-leaf one-center stage, and the scale is 3cm; (c) is the corn leaf at the silking stage, and the scale is 3cm.

[0036]Zebra stripes appeared on the mutant plants from the beginning. As the plants grow, the zebra stripes become more and more obvious. The old leaves appear before the new leaves. After the silking stage, the zebra stripes are stable until the plants mature and senescence , and named the mutant zb9.

[0037] The above-mentioned corn leaf zebra stripe mutation ...

Embodiment 2

[0042] Example 2 Molecular marker primer design of zebra stripe regulatory gene zb9 in maize leaves

[0043] A comparative analysis of the sequencing of 13 candidate genes in the positioning interval between the wild type and the mutant plant zb9 revealed that a single base mutation occurred on the second exon of the ZB9 gene (SEQ ID NO. Mutation from G to A)( image 3 , Figure 4 ), that is, the zb9 mutant gene is an allelic mutant gene of the ZB9 gene. Primers were designed at both ends of this mutation site to obtain polymorphic InDel markers between wild type and mutant zb9. The primer sequences are as follows:

[0044] Upstream (F): AGTCGCTGTTGGGAGGTTAC (SEQ ID No. 3)

[0045] Downstream (R): CTTCTCCAGGGCTGCTATGT (SEQ ID No. 4)

[0046] PCR amplification was performed with the designed primers. The PCR reaction system was: 7.5 μL of Taq Mix, 0.75 μL of upstream and downstream primers, 1 μL of DNA template, and distilled water to 15 μL.

[0047] The PCR amplificatio...

Embodiment 3

[0048] Example 3 Zebra stripe-related pigment changes in maize leaves and observation of chloroplast ultrastructure

[0049] 1. Changes in related pigments of corn leaves at seedling stage

[0050] The leaves of the zebra-striped mutant zb9 and the wild-type RP125 at the maize silking stage were taken, and the changes in chlorophyll a, b (Chl a, Chl b), total chlorophyll (Total Chl) and carotenoids (Car) were measured, and the results showed that Chlorophyll a and b, total chlorophyll and carotenoids (Car) in the mutants were significantly changed (Table 1). Among them, there is also a big difference in the pigments of the striped part and the green part of the zebra-striped mutant of maize leaves, and the substantial reduction in chlorophyll content has seriously affected the photosynthesis of plants. In this study, the pigment content was determined by conventional spectrophotometer method.

[0051] Table 1 Pigment determination in mutant zb9 and wild-type RP125

[0052] ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a maize leaf zebra stripe leaf color gene zb9, an InDel molecular marker linked with the maize leaf zebra stripe leaf color gene zb9 and application. The nucleotide sequence ofthe gene is as shown in SEQ ID NO.1, and the gene includes a single-base mutation on a second exon in a coding region, and a mutation site is G / A; specific sequences of a primer pair are shown in SEQID NO.3 and SEQ ID NO.4. The InDel molecular marker disclosed by the invention is closely linked with the maize leaf zebra stripe regulatory gene zb9, can be used for identifying whether a plant contains the maize leaf zebra stripe regulatory mutant gene zb9 or not, has a reliable detection result, and is simple and feasible.

Description

technical field [0001] The invention belongs to the field of molecular genetics, in particular to a corn leaf zebra stripe leaf color gene zb9 and its linked InDel molecular marker and application. Background technique [0002] As the most widely planted food crop in the world, corn plays an important role in agricultural production. my country is a big country in corn production and consumption, with the sown area, total production and consumption ranking second only to the United States (Li Shaokun et al., 2017). However, the yield of corn per unit area in my country is far lower than that of the United States. Therefore, it is extremely important to increase the yield of corn on limited land. The high and stable yield of corn is of great significance to ensure the food security of our country. [0003] Maize is an important C4 plant, 90% of its dry weight yield comes from the photosynthesis of leaves, which has an important impact on the accumulation of dry matter. There...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/29C12Q1/6895C12N15/11
CPCC07K14/415C12Q1/6895C12Q2600/156C12Q2600/13
Inventor 袁广胜沈亚欧潘光堂何慧史家豪杨焱王智颖李玉璀陈本芳马浪浪邹超英
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com