CRISPR/Cas9 vector suitable for paraconiothyrium hawaiiense FS482 as well as construction method and application of CRISPR/Cas9 vector

A technology of FS482 and construction method, which is applied in the field of biochemistry and molecular biology, can solve the problems of low knockout efficiency and achieve the effects of high gene knockout efficiency, efficient knockout, and simple vector construction

Active Publication Date: 2021-03-26
GUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The CRISPR / Cas9 system has been widely used in genome editing of mammalian cells, stem cells, yeast, and bacteria due to its advantages of simple construction, relatively high gene knockout efficiency, strong controllability, and low cost. The relatively complex genetic background caused by the unique habitat of fungi, and the knockout efficiency of the CRISPR / Cas9 system is relatively low in filamentous fungi

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cas9 vector suitable for paraconiothyrium hawaiiense FS482 as well as construction method and application of CRISPR/Cas9 vector
  • CRISPR/Cas9 vector suitable for paraconiothyrium hawaiiense FS482 as well as construction method and application of CRISPR/Cas9 vector
  • CRISPR/Cas9 vector suitable for paraconiothyrium hawaiiense FS482 as well as construction method and application of CRISPR/Cas9 vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Construction of gene knockout vector targeting new skeleton diterpene compound biosynthesis

[0032]On the basis of the original pFC332 plasmid, pFC332 was digested with PacI, and homology arm sequences were designed on both sides of the Cas9 gene promoter of the pFC332 vector, combined with the pG base sequence of the FS110 promoter of Dichotomyces cejpii (the pG promoter In vitro luciferase transcription activity experiment and hygromycin resistance gene screening yeast experiment confirmed that it has stronger transcription activity than pgpdA promoter), and designed primer sequences pG-F:CATCTAGAGGGCCGCTTAATgaggaccgctcgtcccctat and pG-R:ctagtaatgcgtagaggtgcgtctgccatggtgatgggac; Dichotomycescejpii) FS110 genome was used as a template, and the above-mentioned pG-F and pG-R were used as primers to amplify the pG promoter sequence. PCR program: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for...

Embodiment 2

[0041] Knockout of P450 gene biosynthesis genes in P._hawaiiense FS482:

[0042] The method of introducing exogenous gene into P._hawaiiense FS482 protoplast is as follows:

[0043] (1) The preparation method of P._hawaiiense FS482 protoplasts is as follows:

[0044] Pick an appropriate amount of mycelium of P._hawaiiense FS482 and inoculate it in 200mL PDA liquid medium, and culture it at 30°C and 180r / min for 7 days. Filter the bacterial solution with two layers of gauze, select 2 g (wet weight) of well-growth bacterial spheres into a 50 mL centrifuge tube, and wash twice with PBS buffer to fully wash away the residual PDA medium. Weigh 0.15g lysozyme (sigma, USA) and dissolve in 20mL KC buffer (0.6M KCl, 0.05M CaCl 2 ), and filtered with a 0.22 μm filter membrane, and added to the washed bacterial balls. Cleavage at 28°C and 68rpm for about 3 hours. Filter the lysate with a 200-mesh filter, filter the hyphae, and filter again with 8 layers of sterile lens tissue, centri...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a CRISPR / Cas9 vector suitable for paraconiothyrium hawaiiense FS482 as well as a construction method and application of the CRISPR / Cas9 vector. According to the invention, a recombinant paraconiothyrium hawaiiense FS482 strain with knocked-out diterpenoid new skeleton compound biosynthetic genes is constructed by utilizing a novel CRISPR / Cas9 system after promoter optimization for the first time, and an efficient CRISPR / Cas9 gene knockout system suitable for deep sea fungus paraconiothyrium hawaiiense FS482 is established; and therefore, a molecular biological foundation is laid for clarification of a biosynthesis mechanism of the novel active secondary metabolite of the paraconiothyrium hawaiiense FS482 and obtaining of more novel secondary metabolites with remarkable biological activity.

Description

technical field [0001] The invention belongs to the technical field of biochemistry and molecular biology, and in particular relates to a CRISPR / Cas9 vector suitable for Pseudomonas shield FS482 and its construction method and application. Background technique [0002] The deep-sea fungus Paraconiothyrium_hawaiiense FS482 is a kind of shell fungus from the deep sea. This fungus can produce new skeleton diterpenoids that can inhibit angiotensin-converting enzymes, so it has the potential to discover the lead compounds of antihypertensive drugs. On this basis, the genome of P._hawaiiense FS482 was sequenced, and the biosynthetic gene cluster of the new backbone compound was predicted. It is predicted that the compound is biosynthesized by cluster 66 containing terpene cyclase, P450 monooxygenase and methyltransferase, and P450 monooxygenase plays an important role in the formation and modification of its backbone. Therefore, it is necessary to delete P450 to verify its functi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/80C12N15/66C12R1/645
CPCC12N15/80C12N15/66C12N9/0071
Inventor叶伟章卫民徐诗航李赛妮陈书帅刘昭明张维阳许丽琼
OwnerGUANGDONG INST OF MICROBIOLOGY GUANGDONG DETECTION CENT OF MICROBIOLOGY