One-pot nucleic acid detection method based on CasRNA enzyme and application
A detection method and nucleic acid technology, which is applied in the field of one-pot nucleic acid detection based on CasRNA enzyme, can solve problems such as prone to false positive results, inability to achieve quantification, and poor detection stability, so as to shorten the detection time and the required time , good effect of specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0061] This embodiment provides a one-pot nucleic acid detection method based on Cas RNase, and the specific steps are as follows:
[0062] (1) Preparation of reaction system
[0063] Mix DNA recombinase, DNA polymerase, T7 transcriptase, dNTP, NTP, RPA forward primer, RPA reverse primer, Cas13a, crRNA, probe RNA and buffer, and then mix with the solution to be tested to obtain the reaction system ;
[0064] Among them, based on the 50 μL reaction system, the components and their concentrations and usage amounts are shown in Table 1 below:
[0065] Table 1
[0066]
[0067]
[0068] Among them, the lyophilized reaction microspheres are commercial RPA basic reaction units, including DNA recombinase, DNA polymerase, T7 transcriptase and dNTP; the amount of the solution to be tested can be adjusted according to the actual situation, and finally made up to 50 μL with water.
[0069] (2) Place the solution prepared above for reaction at 37°C, and at the same time detect th...
Embodiment 2
[0072] In this example, the one-pot nucleic acid detection method provided in Example 1 was used to detect the target DNA.
[0073] Wherein, the target DNA in the solution to be tested is the template strand Template-sense (SEQ ID NO.1) is:
[0074] 5′-AGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATTCTTCAACCTAGGA-3′;
[0075] Its complementary sequence, that is, the template-antisense strand Template-antisense (SEQ ID NO.2) is:
[0076] 5′-TCCTAGGTTGAAGATAACCCACATAATAAGCTGCAGCACCAGCTGTCCAACCTGAAGAAGAATCACCAGGAGTCAAATAACTTCTATGTAAAGCAAGTAAAGTTTGAAACCT-3′;
[0077] The forward primer (SEQ ID NO.3) used in the reaction system is:
[0078] 5′-GAAAT TAATACGACTCACTATAGGG AGGTTTCAAACTTTACTTGCTTTACATAGA-3'; wherein, the underlined sequence is the T7 promoter, and the GAAAT before the T7 promoter can be any sequence, in order to increase the efficiency of T7 transcription;
[0079] The reverse primer Reverse Primer (SEQ ID NO.4)...
Embodiment 3
[0089] In this example, the one-pot nucleic acid detection method provided in Example 1 was used to detect the target DNA in Pseudomonas aeruginosa.
[0090] Wherein, the target DNA in Pseudomonas aeruginosa, that is, the template strand Template-sense (SEQ ID NO.7) is:
[0091] 5′-GAGAATGACAAAGTGGAACTGGTGATCCGCCTGGGCGAGAACAACATCGCCCAACTGGTCTACAACGTCTCCTACCTGATTCCCGGCGAGGGACTGTCGCGGCCGCATTTCGTCATCGACGCCAAGACCGGCGAAGTGCTCGATCAGTGGGAAGGCCTGGC-3′;
[0092] Its complementary sequence, that is, the template-antisense strand Template-antisense (SEQ ID NO.8) is:
[0093] 5′-GCCAGGCCTTCCCACTGATCGAGCACTTCGCCGGTCTTGGCGTCGATGACGAAATGCGGCCGCGACAGTCCCTCGCCGGGAATCAGGTAGGAGACGTTGTAGACCAGTTGGGCGATGTTGTTCTCGCCCAGGCGGATCACCAGTTCCACTTTGTCATTCTC-3′;
[0094] The forward primer (SEQ ID NO.9) used in the reaction system is:
[0095] 5′-GAAAT TAATACGACTCACTATAGGG AGAATGACAAAGTGGAACTGGTGATCCGCCTG-3'; wherein, the underlined sequence is the T7 promoter, and the GAAAT before the T7 promoter can be ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More