Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth, high fertility and resistance to series epidemic diseases and application thereof

A technology of recombinant cells and plasmids, applied in the biological field, can solve problems such as inability to infect live pigs, inactivation of receptor proteins, and reduced infectivity.

Active Publication Date: 2021-05-11
NANJING KGENE GENETIC ENG CO LTD
View PDF4 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Destroying the pAPN gene will inactivate the receptor protein encoded by it, the TGEV virus cannot infect live pigs, and the infectivity of PEDV and PDCoV viruses to pigs is also greatly reduced

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth, high fertility and resistance to series epidemic diseases and application thereof
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth, high fertility and resistance to series epidemic diseases and application thereof
  • Method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth, high fertility and resistance to series epidemic diseases and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0100]Example 1, Construction of Plasmid

[0101]1.1 Construction plasmid Pu6GRNA EEF1A-MNLS-HSPCas9-EGFP-PURO (referred to as plasmid pkg-ge3)

[0102]Original plasmid PX330-U6-chiMERIC_BB-CBH-HSPCAS9 (referred to as plasmid PX330), sequence, such as SEQ ID NO: 1. Structure of plasmid PX330figure 1 . In SEQ ID NO.1, the 440-725 nucleotides composition CMV enhancer, sections 727-1208 nucleotides composition Chickenβ-Actin promoter, No. 1304-1324 Nucleotide encoded SV40 nuclear positioning signal (NLS ), No. 1325-5449 Nucleotide encoding Cas9 protein, race 5450-5497 Nucleotide coded Nucleoplasmin nuclear positioning signal (NLS).

[0103]Plasmid PU6GRNA EEF1A-MNLS-HSPCas9-EGFP-PURO (Figure 5 ), Referred to as plasmid PKG-GE3, nucleotide, such as SEQ ID NO: 2. Compared with the plasmid PX330, plasmid PKG-GE3 mainly has been modified as follows: 1 Remove residual GRNA skeleton sequence (gtttAmaAgcccccccccccccccgtttttt), reduce interference; 2 Transform the original Chickenβ-Actin promoter into ...

Embodiment 2

[0116]Example 2 Comparison of plasmid ratio optimization and meta-plasmid PX330 and plasmid PKG-GE3

[0117]2.1 target GRNA design and construction

[0118]2.1.1 Target GRNA Design for Rag1 genes using Benchling

[0119]RAG1-G4: Agttatgcagaactcagtg (seq ID no.9)

[0120]The complementary DNA Oligo of the insertion sequence for the synthesis of the above RAG1 gene target is as follows:

[0121]RAG1-GRNA4S: caccgagttatgcagaactcagtg (seq ID no.10)

[0122]RAG1-GRNA4A: AAACCACTGAGTTCTGCCCCATAACTC (SEQ ID NO.11)

[0123]RAG1-GRNA4S, RAG1-GRNA4A are single-stranded DNA molecules.

[0124]2.1.2 Design for amplification and detection of primers containing RAG1 GRNA target fragment

[0125]RAG1-NF126: ccccatccaaagttttaaagga

[0126]RAG1-NR525: TGTGCAGATGTCAGTTTTAGG

[0127]2.1.3 Construction of GRNA recombinant carrier and cloning

[0128]1) Digest 1 ug PKG-U6GRNA plasmid with restriction endonuclease BBSI;

[0129]2) Separation of PKG-U6GRNA grain routine gel (agarose gel concentration 1%, i.e., 1 g agarose gel added to 100 mL e...

Embodiment 3

[0177]Example 3 Screening an efficient MSTN gene GRNA target

[0178]Pig MSTN gene information: encoded myostatin protein; located in the pig No. 15 chromosome; GeneId is 399534, SUsscrofa. Pig MSTN gene encoding proteins such as GenBank Accession No.NP_999600.2 (Linear Con12-JAN-2018), the amino acid sequence is shown in SEQ ID NO.13. In the genome DNA, the pig MSTN gene has three exons, wherein the first exon and downstream 200bp sequences are shown in SEQ ID NO.14.

[0179]3.1 MSTN gene knockout preset target and adjacent genomic sequence conservative analysis

[0180]18 new students from Jiangxiang pigs, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, 10), male 8 (named A, B, C, D, respectively , E, F, G, H).

[0181]The PCR amplification is performed using primer pairs (primer pair target sequences including pig MSTN gene first exons), respectively, and electrophoresis. The PCR amplification product was recovered and sequenced, and the sequencing results were aligned with the MSTN g...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing high-quality porcine nuclear transplantation donor cells with high lean meat percentage, fast growth, high fertility and resistance to series epidemic diseases and application thereof. A CRISPR / Cas9 system for editing five genes of porcine MSTN, SST, INHA, CD163 and pAPN comprises a Cas9 expression vector and gRNA expression vectors respectively aiming at the porcine MSTN, SST, INHA, CD163 and pAPN genes; and the plasmid complete sequence of the Cas9 expression vector is shown as SEQ ID NO. 2. The corresponding gRNA expression vectors are respectively designed aiming at different target points of the MSTN, SST, INHA, CD163 and pAPN genes, and gRNA with higher editing efficiency and expression vectors thereof are obtained through screening. The gene editing is performed by matching with the modified Cas9 high-efficiency expression vector, and the editing efficiency is obviously improved compared with that of the original vector.

Description

Technical field[0001]The present invention belongs to the biotechnology field, and the CRISPR / CAS9 system for MSTN, SST, INHA, CD163 and PAPN-five genes and its high growth rate, high growth, high reproductive and anti-blue Application of Quality Pig Nuclear Transplantation Differential Cells in Diarrhea.Background technique[0002]Pig is one of the earliest domestic livestock in my country, which has always been an important meat animal in the long river of history. Chinese people love pork, related to diet culture for thousands of years. Since 2000, pork has more than 70% of meat consumption in my country, and is the most important consumption meat in my country. At present, the price of urban lean meat in my country has exceeded the price of more than 1 times, with more than 60% of lean-lean pigmented pigs, and the lean meat-lean sex has a further improvement space. On the other hand, the current domestic hyperfection pig has a weight of about 120kg. The pig is only 180 days from...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/65C12N5/10A01K67/027
CPCC12N15/8509C12N15/65C07K14/47A01K67/0276C12N2310/20A01K2227/108A01K2267/02A01K2267/025
Inventor 牛冬汪滔马翔曾为俊刘璐王磊程锐赵泽英段星陶裴裴黄彩云
Owner NANJING KGENE GENETIC ENG CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com