Single nucleotide mutation site SNP and KASP markers significantly associated with soybean protein content and application thereof

A soybean protein and mutation site technology, applied in the field of molecular genetics and breeding, can solve the problems of time-consuming, labor-intensive, low, susceptible to environmental interference, accuracy, etc.

Active Publication Date: 2021-06-01
JIANGSU ACADEMY OF AGRICULTURAL SCIENCES
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Traditional high-protein soybean breeding is based on the selection of individual plants based on the protein content of the offspring. This method is not only time-consuming and labor-intensive, but also susceptible to environmental interference and has low accuracy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Single nucleotide mutation site SNP and KASP markers significantly associated with soybean protein content and application thereof
  • Single nucleotide mutation site SNP and KASP markers significantly associated with soybean protein content and application thereof
  • Single nucleotide mutation site SNP and KASP markers significantly associated with soybean protein content and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Acquisition of Nucleotide Mutation Sites (SNPs) Significantly Associated with Soybean Protein Content

[0041] (1) Determination of protein content: Take the dried laboratory soybean samples and mix them thoroughly, then crush them, and pass all the grains through a 0.25mm aperture sieve, and put them into sample bottles for later use. Weigh 0.2g of the sample, accurate to 0.0001g, and place it in a 300mL digestion tube. Then the protein was determined according to the method of national standard GB 5009.5-2016.

[0042] (2) DNA extraction and high-throughput sequencing: The CTAB method was used to extract the genomic DNA of 264 young soybean leaves, and the whole genome was resequenced.

[0043] (3) Genome-wide association analysis (GWAS): Using the GAPIT algorithm package in the R language software, the calculation model is a mixed linear model (MLM), GWAS analysis detected 24 SNP sites significantly associated with soybean protein content, and all Locate...

Embodiment 2

[0044] Example 2: Development of KASP marker-specific primers

[0045] Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), three primers were designed according to the sequence of Seq ID NO.1, upstream primer F1 (Seq ID NO.2), upstream primer F2 ( Seq ID NO.3) and downstream primer R (Seq ID NO.4), wherein F1 and F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), the sequences are as follows:

[0046] F1 sequence: 5'- gaaggtgaccaagttcatgct gttgaagtgagatatggtggacg-3'

[0047] F2 sequence: 5'- gaaggtcggagtcaacggatt gttgaagtgagatatggtggaca-3'

[0048] R sequence: 5'-ttccacctcgccattcatcc-3'

Embodiment 3

[0049] Example 3: Detecting genotypes of different varieties of soybean SNP sites and its application

[0050] The genomic DNA of the soybean samples is extracted respectively, and the genomic DNA is used as a template to carry out PCR amplification with KASP labeled special primers to obtain PCR amplification products. PCR amplification was carried out in the ABI7500 real-time fluorescent quantitative PCR instrument. After PCR, the instrument can perform genotyping according to the fluorescent signal. The amplification systems described are all 10 μl reaction systems: soybean sample DNA template, 25ng / μl, 2 μl; 2×KASP Master mix 5 μl; KASPassay Mix, F1:F2:R=2:2:5, 0.14 μl; water 2.9 μl. The reaction conditions included pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing at 61-55°C for 60 sec, 10 cycles with each cycle lowering 0.6°C; denaturation at 94°C for 20 sec, annealing at 55°C for 60 sec, 26 cycles.

[0051] After the reaction is completed...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a single nucleotide mutation site SNP marker and a KASP marker remarkably associated with soybean protein content and application thereof, and belongs to the field of plant molecular breeding. According to the present invention, the SNP S14_73926 significantly associated with the soybean protein content is located at the No.14 chromosome 73,926bp position of the soybean genome v2.0, the base G-A replacement occurs, the phenotypic variation interpretation rate reaches 6.4%, the KASP marker is developed for the SNP site, and the SNP and KASP markers significantly associated with the soybean protein content provided by the present invention can be used for the molecular marker-assisted selection breeding of the soybean protein character, and have important theoretical and practical guiding significance for accelerating the genetic improvement process of soybean high-protein breeding and improving the breeding selection efficiency.

Description

[0001] 1. Technical field [0002] The invention belongs to the field of molecular genetic breeding, and provides a nucleotide mutation site SNP and KASP marker significantly related to soybean protein content and application thereof, which can be used for early molecular assisted selection of soybean protein content traits to improve breeding efficiency. [0003] 2. Background technology [0004] The protein content of soybean is about 40%, which is one of the important sources of human plant protein. The protein provided accounts for about 68% of the total protein consumption in the world. It contains eight essential amino acids that the human body cannot synthesize by itself, so it has high nutritional value . With the improvement of people's dietary standards, the consumption demand for soybean protein continues to increase, and the contradiction between domestic soybean supply and demand becomes more prominent. Therefore, the study of rapid and effective molecular breedin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/6858C12N15/11A01H1/04
CPCC12Q1/6895C12Q1/6858A01H1/04C12Q2600/13C12Q2600/156C12Q2531/113C12Q2563/107
Inventor陈华涛张威许文静张红梅崔晓艳刘晓庆陈新
OwnerJIANGSU ACADEMY OF AGRICULTURAL SCIENCES