Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant bacillus methylotrophicus as well as construction method and application thereof

A technology of methylbutyric acid bacteria and methyl butyric acid, applied in the field of recombinant methyl butyric acid bacteria and its construction, to achieve the effect of increasing production

Pending Publication Date: 2021-07-13
NANJING UNIV OF TECH
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still room for further improvement in the methanol consumption rate and butyric acid production efficiency of Bacillus methylbutyricum

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant bacillus methylotrophicus as well as construction method and application thereof
  • Recombinant bacillus methylotrophicus as well as construction method and application thereof
  • Recombinant bacillus methylotrophicus as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Constructing recombinant plasmid pxy1-MTAA / MTAB / MTAC2

[0028] The genes used in the examples used in the examples are from buMe_rs16910, buMe_rs16905, buMe_rs16900, buMe_rs03485, buMe_rs03475, buMe_rs0347, respectively. Gene MATA, MTAB, MTAC2, ATOB, PAAH, CRT, BCD were endogenous endogenous genes, and the eatenylbutyrobacteria purchased from the ATCC strain preservation center.

[0029] Methanol overduction gene MTAb / MTAC2 / MTAA base sequence, that is, (methanol utilizing the pathway related gene SEQ NO.1):

[0030]atggcaaagaaatttgataaactggcaattaataatctggacgattttatttatggctcttgtccgaaccctgtcaccac caggagcggcatggtcatcggcggcggcaccatctatccggaaatcaacttcacactgccgggcatggatgtcaatgatc agaccattgacaaggccttgggcatttattccaatatcatcgacggtgtgctcaagagagcggcagagctctacgcgccc ggcgtgctggtagaatttgaaaccgtgccggactttaccgagcatccaaaatatgggattgacgccaaccgcattttatt aaatggcatcaaggaagccgcagacaagtacggcctcaaggccgccctgcggaccacccccaacgacctgcgcgaaatga gccgtcctccggttatgcgcggcggcaagtactgggataccat...

Embodiment 2

[0037] Example 2: Constructing recombinant strain BM / PXY1-MTAA / MTAB / MTAC2

[0038] Construction of recombinant strain BM / PXY1-MTAA / MTAb / mTAC2: Transformation of plasmid PMCljs into E. coli T1 / PMClJS to obtain recombinant strains, to prepare cells, specific steps As follows:

[0039] From the LB plate, a newly activated T1 / PMCLJS single colonies were seized in 5 ml of LB medium containing strong oxychromycin, and cultured at 37 ° C to a long period of time, and the strain was seeded in 50 ml of liquid medium. Medium, cultured to OD 37 ° C 600 = 0.4-0.5; Pour the bacterial liquid into the centrifuge tube, put 10 min on ice, 4000 rpm at 4 ° C for 10 min; discard the supernatant, with pre-cool 0.1 mol / L CaCl 2 The solution is 10 ml to gently suspend cells, placed on ice 15 min, 4000 rpm at 4 ° C for 10 min, repeat this step 2 times; discard the supernatant, add 5 mL to pre-cooling 15% glycerol 0.1 mol / l CaCl 2 The solution was gently suspended cells, and the ice wa...

Embodiment 3

[0042] Example 3: Recombinant strain BM / PXY1-MTAA / MTAb / MTAC2 fermentation experiment

[0043] The recombinant strain BM / PXY1-MTAA / MTAB / MTAC2 single colonies were collected on the plate, which was inoculated to 1 ml YTF medium containing erythromycin (1 g / L, yeast powder 12g / L, sodium chloride 4g / L, glucose) In 5g / L), after 12-16 h, the bacterial liquid in the centrifuge tube was transferred to the annesate bottle, grown to OD. 600 For about 1, pour the bacterial solution into 50 ml of centrifuge tube, 4000 rpm centrifuge for 10min, discard the supernatant, use Pb medium to retain it with OD 600 The amount of inoculation of 0.1 was inoculated into 50 ml of Pb medium, and 100 mM methanol was added, and 2 ml of bacterial liquid was added every 24 h. After centrifugation, the supernatant was transferred to a new centrifuge tube, and methanol was used for high performance liquid chromatography. Butyric acid. Detect its OD after 2 ml of ultrapure water 600 , Compared...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant butyric acid bacillus methylotrophicus as well as a construction method and application thereof. By taking bacillus methylotrophicus as a source, the genetically engineered bacteria for over-expression methanol utilization and butyric acid synthesis are constructed, i.e. BM / pXY1-mtaA / mtaB / mtaC2 and BM / pXY1-atoB / paaH / crt / bcd. The methanol utilization capacity and the butyric acid synthesis capacity of the recombinant strain are remarkably enhanced, and the methanol consumption capacity in a PB culture medium is improved by 69% and 14% respectively; and the yield of butyric acid is respectively increased by 38% and 28.6%. A foundation is laid for further improving the consumption capacity of methanol.

Description

Technical field [0001] The present invention belongs to the field of microbial gene engineering, and more particularly to a recombinant methabus butcetate bacterium and its construction method thereof. Background technique [0002] Methanol is a colorless transparent liquid with irritating odor. Methanol as a biological production of raw materials has the following more significant advantages: methanol and does not require higher compression and reduced pressure safety, transportation costs; methanol is reduced by higher than glucose, using methanol as a unique or assisted carbon source to produce Restorestive chemicals including organic acids are expected to achieve higher product production. The main method of current production of methanol is the chemical synthesis method, that is, the synthesis gas of the calcinated fuel, direct oxidation of methane, reducing the carbon dioxide and hydrogen in the atmosphere, and has a large number of raw materials of methanol, and the constr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/74C12P7/52C12R1/145
CPCC07K14/33C12N15/74C12P7/52Y02E50/10
Inventor 陈可泉秦家伦王昕王雪麟马琛
Owner NANJING UNIV OF TECH