Nanoparticle based coronavirus vaccine
A nanoparticle and coronavirus technology, applied in the field of biomedicine, can solve the problems of nano vaccines that have not been reported, and achieve good broad-spectrum immune effect, high industrialization value, and simple renaturation process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0159] Example 1: Construction, expression, activity detection and purification of RBM-HFn fusion protein
[0160] 1. Construction of RBM-HFn fusion protein
[0161] The RBM-HFn fusion protein was constructed, and the coding gene sequence was optimized according to the codon preference of Escherichia coli to obtain the optimized RBM-HFn (number: XYD-403-000) gene, whose specific sequence is as follows:
[0162] ATGAATAGTAATAATCTGGATTCTAAAGTGGGCGGCAATTATAATTATCTGTATCGCCTGTTTCGTAAATCAAATCTGAAACCGTTTGAACGCGATATTAGTACCGAAATTTATCAGGCAGGCTCTACCCCGTGTAATGGTGTTGAAGGCTTTAATTGTTATTTTCCGCTTCAAAGCTATGGCTTTCAGCCGACCAATGGCGTTGGCTATCAGCCGTATGGTGGTGGCGGTTCAGGCGGCGGTGGTAGCGGCGGTGGCGGTAGTACCACCGCAAGCACCTCACAGGTTCGTCAGAATTATCATCAGGATAGCGAAGCAGCAATTAATCGCCAGATTAATCTGGAACTGTATGCAAGCTATGTGTATCTGAGTATGTCTTATTATTTTGATCGCGATGATGTTGCACTGAAAAATTTTGCAAAATATTTTCTGCATCAGTCTCATGAAGAACGCGAACATGCAGAAAAACTGATGAAACTCCAAAATCAGCGTGGTGGTCGCATTTTTCTTCAAGATATTAAAAAACCGGATTGTGATGATTGGGAAAGTGGCCTGAATGCAATGGAATGTGCACTGC...
Embodiment 2
[0198] Preparation of embodiment 2RBM-HFn antiserum and serum effect detection
[0199] 1. Mouse Immunization and Preparation of Antisera
[0200] The protein concentration of RBM-HFn obtained in Example 1 was measured, and then diluted to the working concentration with normal saline, and the group using adjuvant was diluted to 2 times the working concentration, and immunoadjuvant 504 (Chengdu Yisi Kang Medical Technology Co., Ltd. company) equal volumes were mixed and emulsified.
[0201] The 6-8 week-old Balb / C mice were immunized in groups, 10 in each group. The immunization schedule of each group is shown in Table 2. By subcutaneous injection, each mouse received three times of antigen protein immunization on day 0, day 14, and day 28; orbital extraction was performed on day -3, day 7, day 21, and day 35. Blood. The mouse serum was obtained by centrifuging at 2800rpm at 4°C for 15 minutes after standing for a period of time to allow the serum to separate out, and was i...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 


