Supercharge Your Innovation With Domain-Expert AI Agents!

Nanoparticle based coronavirus vaccine

A nanoparticle and coronavirus technology, applied in the field of biomedicine, can solve the problems of nano vaccines that have not been reported, and achieve good broad-spectrum immune effect, high industrialization value, and simple renaturation process

Active Publication Date: 2021-07-16
CHINA SCI XINYUN BIOTECH BEIJING CO LTD
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And so far, adopt ferritin as the nano-vaccine of coronavirus has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nanoparticle based coronavirus vaccine
  • Nanoparticle based coronavirus vaccine
  • Nanoparticle based coronavirus vaccine

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0159] Example 1: Construction, expression, activity detection and purification of RBM-HFn fusion protein

[0160] 1. Construction of RBM-HFn fusion protein

[0161] The RBM-HFn fusion protein was constructed, and the coding gene sequence was optimized according to the codon preference of Escherichia coli to obtain the optimized RBM-HFn (number: XYD-403-000) gene, whose specific sequence is as follows:

[0162] ATGAATAGTAATAATCTGGATTCTAAAGTGGGCGGCAATTATAATTATCTGTATCGCCTGTTTCGTAAATCAAATCTGAAACCGTTTGAACGCGATATTAGTACCGAAATTTATCAGGCAGGCTCTACCCCGTGTAATGGTGTTGAAGGCTTTAATTGTTATTTTCCGCTTCAAAGCTATGGCTTTCAGCCGACCAATGGCGTTGGCTATCAGCCGTATGGTGGTGGCGGTTCAGGCGGCGGTGGTAGCGGCGGTGGCGGTAGTACCACCGCAAGCACCTCACAGGTTCGTCAGAATTATCATCAGGATAGCGAAGCAGCAATTAATCGCCAGATTAATCTGGAACTGTATGCAAGCTATGTGTATCTGAGTATGTCTTATTATTTTGATCGCGATGATGTTGCACTGAAAAATTTTGCAAAATATTTTCTGCATCAGTCTCATGAAGAACGCGAACATGCAGAAAAACTGATGAAACTCCAAAATCAGCGTGGTGGTCGCATTTTTCTTCAAGATATTAAAAAACCGGATTGTGATGATTGGGAAAGTGGCCTGAATGCAATGGAATGTGCACTGC...

Embodiment 2

[0198] Preparation of embodiment 2RBM-HFn antiserum and serum effect detection

[0199] 1. Mouse Immunization and Preparation of Antisera

[0200] The protein concentration of RBM-HFn obtained in Example 1 was measured, and then diluted to the working concentration with normal saline, and the group using adjuvant was diluted to 2 times the working concentration, and immunoadjuvant 504 (Chengdu Yisi Kang Medical Technology Co., Ltd. company) equal volumes were mixed and emulsified.

[0201] The 6-8 week-old Balb / C mice were immunized in groups, 10 in each group. The immunization schedule of each group is shown in Table 2. By subcutaneous injection, each mouse received three times of antigen protein immunization on day 0, day 14, and day 28; orbital extraction was performed on day -3, day 7, day 21, and day 35. Blood. The mouse serum was obtained by centrifuging at 2800rpm at 4°C for 15 minutes after standing for a period of time to allow the serum to separate out, and was i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
particle sizeaaaaaaaaaa
Login to View More

Abstract

The invention provides a nanoparticle based coronavirus vaccine. The vaccine includes nanoparticles, the nanoparticles include fusion protein, wherein the fusion protein includes at least one immunogenic part of S protein of viruses in coronaviridae and at least one part of a self-assembled monomer subunit connected to the at least one immunogenic part of the S protein; and the at least one immunogenic part of the S protein is shown on the surfaces of the nanoparticles. The coronavirus vaccine can be used for preventing and / or treating coronavirus infections.

Description

technical field [0001] The invention belongs to the field of biomedicine, in particular to a nanoparticle-based coronavirus vaccine. Background technique [0002] The new coronavirus pneumonia (COVID-19) caused by the new coronavirus (SARS-CoV-2) is a sudden disease that poses a major threat to human health after SARS. [0003] On January 7, 2020, the Wuhan Institute of Virology, Chinese Academy of Sciences detected a new type of coronavirus and obtained the full genome sequence of the virus. On February 3, by comparing the partial sequence of the new coronavirus and the coronavirus detected earlier in the laboratory, it was found that the sequence of the new coronavirus was as high as 96% consistent with a coronavirus gene sequence of a bat sample. SARS-CoV-2 can invade cells in the same way as SARS-CoV, namely by binding to human ACE2 cell receptors. [0004] SARS-CoV-2 is an enveloped, single-stranded positive-sense RNA virus whose spike protein (S) protrudes from the s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21B82Y5/00B82Y40/00A61K39/215A61K39/385A61P31/14A61P11/00C12R1/19
CPCC07K14/005C07K14/47C12N15/70B82Y5/00B82Y40/00A61K39/12A61K39/385A61P31/14A61P11/00C12N2770/20022C12N2770/20034C07K2319/00A61K2039/6031Y02A50/30
Inventor 柯天一姚德惠劳芳张泽译丁凤姣王晓飞刘岩王闯成健伟欧阳芳幸
Owner CHINA SCI XINYUN BIOTECH BEIJING CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More