Unlock instant, AI-driven research and patent intelligence for your innovation.

Specific primers and probe for detecting group B streptococcus and application

A streptococcus, specific technology, applied in the field of medical detection, can solve the problems of long detection time, low sensitivity, long incubation time, etc., and achieve the effects of good sensitivity, high sensitivity, and short detection time

Active Publication Date: 2021-08-13
BEIJING KANGMEI TIANHONG BIOTECH +1
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the culture method has a low sensitivity due to the long culture time, while the immunological method has limited its clinical application due to the need for culture and the long detection time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primers and probe for detecting group B streptococcus and application
  • Specific primers and probe for detecting group B streptococcus and application
  • Specific primers and probe for detecting group B streptococcus and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Design of screening primers

[0044] In the present invention, the surface protein C5a peptidase (scpB) target gene sequence (158bp) is selected based on the reference sequence of the Group B Streptococcus ScpB gene (GenBank: U56908.1):

[0045] SEQ ID NO.7:

[0046] AAGAACCTTACCGCCTAGAAGGTGCGATGCCTGAGGCTCAATTGCTTTTGATGCGTGTCGAAATTGTAAATGGACTAGCAGACTATGCTCGTAACTACGCTCAAGCTATCAGAGATGCTATCAACTTGGGAGCTAAGGTGATTAATATGAGCTTTGGTAATGCTGCACTAGCTTACGCCAACCTTCCAGACGAAACCAAAAAAGCCTTTGACTATGCCAAATCAAAAGGTGTTAGCATTGTGACCTCAGCTGGTAATGATAGTAGCTTTGGGGGCAAG。

[0047] According to the target sequence, the present invention designs three sets of primers by itself:

[0048]

[0049]In order to investigate the amplification effects of the above three groups of primer probes, a certain concentration of group B streptococcus culture solution was added to the oral and throat swab samples to simulate clinical samples for nucleic acid extraction. The specific method is as follows; ...

Embodiment 2

[0064] Embodiment 2 examines the specificity of primer probe

[0065] 1. Template DNA preparation: adjust the concentration with TE buffer to obtain a DNA solution with a DNA concentration of 10 copies / μL.

[0066] 2. System configuration

[0067]

[0068] 3. Fluorescent PCR amplification

[0069] 3.1 Reaction system (30 μL): 20 μL of PCR amplification reaction solution + 10 μL of template DNA solution.

[0070] 3.2 Reaction program: 50°C for 2min; 95°C for 3min; 95°C for 10sec, 64°C for 30sec, 40 cycles (collect fluorescence signal at 64°C).

[0071] 4. Result judgment

[0072] 4.1 GBS positive: CY5 fluorescence Ct ≤ 40.0 or no Ct value, FAM fluorescence amplification curve presents a typical "S" type and Ct ≤ 37.0;

[0073] 4.2 GBS negative (below the detection limit): CY5 fluorescence Ct<40.0, FAM fluorescence GBS gene Ct=40.0 or no Ct value;

[0074] 4.3 Sample detection gray area: If FAM fluorescence 37.0

Embodiment 3

[0080] Example 3 Sensitivity experiment

[0081] 3.1 Determination of detection sensitivity

[0082] According to the above reaction system components and concentration parameters, three batches of reaction systems were prepared, the batch numbers were 190110, 190111 and 190112 respectively, and the specifications were 32 servings / box.

[0083] 1. Determination of kit sensitivity

[0084] Dilute the GBS plasmid into two concentrations of 100Copies / µL and 10Copies / µL, as a template for determining sensitivity, perform amplification detection according to the reaction procedure in Example 2, repeat 10 reactions each, and select the plasmid concentration that can be stably detected as The minimum detectable concentration of this reagent. The result of the reaction is as follows:

[0085] Table 4 Detection sensitivity experiment

[0086]

[0087] The results are shown in Table 4. In 10 repeated experiments, all GBS plasmids could be detected when the concentration was 10Cop...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of medical detection, and particularly relates to specific primers and a probe for detecting group B streptococcus and application. According to the specific primers and the probe for detecting the group B streptococcus, the nucleotide sequences of the primers are as shown in SEQ ID NO.1 and SEQ ID NO.2; and the nucleotide sequence of the probe is as shown in SEQ ID NO. 3. The lowest detectable copy number by the primers and the probe disclosed by the invention is 10 copies / [mu]L, and the primers and the probe have good sensitivity; a plasmid with the concentration of 10<4> copies / [mu]L is used as a template for precision detection, the reaction is repeated for 10 times, and the variation coefficients in and among continuous three reagent batches are all less than 5%; and a reaction system provided by the invention has strong anti-interference performance and can resist the influence of common interference substances.

Description

technical field [0001] The invention belongs to the field of medical detection, and in particular relates to specific primers, probes and applications for detecting group B streptococci. Background technique [0002] Group B Streptococcus (GBS for short) is an opportunistic pathogenic bacteria that normally resides in the vagina and rectum. Infection with GBS in normal healthy people does not cause disease. But Group B Streptococcus can cause neonatal sepsis, pneumonia, meningitis, and even death. Neonates who survive infection may also have severe neurological sequelae, including hydrocephalus, intellectual disability, microcephaly, and deafness. At the same time, Group B Streptococcus can also cause infections in pregnant women, premature birth, fetal dysplasia (low birth weight children), premature rupture of membranes and late miscarriage. According to statistics, about 10% to 30% of pregnant women are infected with GBS, and 40% to 70% of them will be passed on to the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/04C12N15/11C12R1/46
CPCC12Q1/689
Inventor 柳辉沈亚南郑文果毕少辉
Owner BEIJING KANGMEI TIANHONG BIOTECH