Specific primers and probe for detecting group B streptococcus and application
A streptococcus, specific technology, applied in the field of medical detection, can solve the problems of long detection time, low sensitivity, long incubation time, etc., and achieve the effects of good sensitivity, high sensitivity, and short detection time
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0043] Example 1 Design of screening primers
[0044] In the present invention, the surface protein C5a peptidase (scpB) target gene sequence (158bp) is selected based on the reference sequence of the Group B Streptococcus ScpB gene (GenBank: U56908.1):
[0045] SEQ ID NO.7:
[0046] AAGAACCTTACCGCCTAGAAGGTGCGATGCCTGAGGCTCAATTGCTTTTGATGCGTGTCGAAATTGTAAATGGACTAGCAGACTATGCTCGTAACTACGCTCAAGCTATCAGAGATGCTATCAACTTGGGAGCTAAGGTGATTAATATGAGCTTTGGTAATGCTGCACTAGCTTACGCCAACCTTCCAGACGAAACCAAAAAAGCCTTTGACTATGCCAAATCAAAAGGTGTTAGCATTGTGACCTCAGCTGGTAATGATAGTAGCTTTGGGGGCAAG。
[0047] According to the target sequence, the present invention designs three sets of primers by itself:
[0048]
[0049]In order to investigate the amplification effects of the above three groups of primer probes, a certain concentration of group B streptococcus culture solution was added to the oral and throat swab samples to simulate clinical samples for nucleic acid extraction. The specific method is as follows; ...
Embodiment 2
[0064] Embodiment 2 examines the specificity of primer probe
[0065] 1. Template DNA preparation: adjust the concentration with TE buffer to obtain a DNA solution with a DNA concentration of 10 copies / μL.
[0066] 2. System configuration
[0067]
[0068] 3. Fluorescent PCR amplification
[0069] 3.1 Reaction system (30 μL): 20 μL of PCR amplification reaction solution + 10 μL of template DNA solution.
[0070] 3.2 Reaction program: 50°C for 2min; 95°C for 3min; 95°C for 10sec, 64°C for 30sec, 40 cycles (collect fluorescence signal at 64°C).
[0071] 4. Result judgment
[0072] 4.1 GBS positive: CY5 fluorescence Ct ≤ 40.0 or no Ct value, FAM fluorescence amplification curve presents a typical "S" type and Ct ≤ 37.0;
[0073] 4.2 GBS negative (below the detection limit): CY5 fluorescence Ct<40.0, FAM fluorescence GBS gene Ct=40.0 or no Ct value;
[0074] 4.3 Sample detection gray area: If FAM fluorescence 37.0
Embodiment 3
[0080] Example 3 Sensitivity experiment
[0081] 3.1 Determination of detection sensitivity
[0082] According to the above reaction system components and concentration parameters, three batches of reaction systems were prepared, the batch numbers were 190110, 190111 and 190112 respectively, and the specifications were 32 servings / box.
[0083] 1. Determination of kit sensitivity
[0084] Dilute the GBS plasmid into two concentrations of 100Copies / µL and 10Copies / µL, as a template for determining sensitivity, perform amplification detection according to the reaction procedure in Example 2, repeat 10 reactions each, and select the plasmid concentration that can be stably detected as The minimum detectable concentration of this reagent. The result of the reaction is as follows:
[0085] Table 4 Detection sensitivity experiment
[0086]
[0087] The results are shown in Table 4. In 10 repeated experiments, all GBS plasmids could be detected when the concentration was 10Cop...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


