M13 bacteriophage nanoprobe and preparation method thereof

A nano-probe and phage technology, applied in phage, virus/phage, botanical equipment and methods, etc., can solve the problems of low biological safety, long reaction time, poor monodispersity, etc., and achieve high collision efficiency and long binding time Short, good monodisperse effect

Pending Publication Date: 2021-08-27
YANGZHOU UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are also some shortcomings, such as the high long diameter and filamentous structure of M13 phage, which make it poor in monodispersity when used as a detection probe, longer reaction time is required for detection, and the binding efficiency is low; recombinant M13 phage can be used as a virus Can replicate in E. coli in the microbial community, relatively low biosafety

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • M13 bacteriophage nanoprobe and preparation method thereof
  • M13 bacteriophage nanoprobe and preparation method thereof
  • M13 bacteriophage nanoprobe and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1: Taking Affinity Porcine Epidemic Diarrhea Virus (PEDV) and Gold Nanoparticle Probe as an Example to Construct M13KO7 Phage Nanoprobe

[0066] 1. Transformation of the helper phage M13KO7 of the affinity virus: use M13KO7 as a primer design template, design a primer with the base sequence (GCGGGGTGGTATTGTACGGAGGTGTTGTGTGTTCAG) of the affinity PEDV polypeptide (AGWYCTEVLCVQ) as the homology arm primer, and insert the affinity PEDV polypeptide sequence into the P3 protein Between the end of the signal peptide and the first amino acid (Table 1, primers F1, R2, F3, R3 underlined part is the base sequence of the affinity PEDV polypeptide). Using M13KO7 as the template for amplification, using high-fidelity enzymes High-Fidelity 2×Master Mix for PCR amplification. Analysis of the amplified product by 1% agarose gel electrophoresis showed that the target fragment was not amplified by using primers F1 and R1, F2 and R2; fragment 1 containing the base sequence of the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a bacteriophage nanoprobe and a preparation method thereof. The bacteriophage nanoprobe is an M13 bacteriophage derivative, firstly, polypeptide of an affinity virus is displayed at an N end of P3 protein of a helper bacteriophage M13KO7, polypeptide of an affinity nanoparticle is displayed at an N end of P8 protein, the polypeptide of the affinity nanoparticle is displayed at an N end of P8 protein, and then, the modified helper phage M13KO7 is used for infecting a phage liquid containing a replication starting point ori(+) and a packaging signal, so that the phage is packaged by the modified helper phage M13KO7, and the phage nano probe which is 50-100 nm long and is used for virus detection is assembled. The product prepared by the invention has the characteristics of high specificity, good sensitivity, high biological safety, capability of realizing visual detection of viruses, wide application field and the like, in addition, the process is simple and convenient, the cost is relatively low, a result can be observed by naked eyes, and an electrochemical signal can be generated by utilizing a biosensor, so that the product has a very good popularization prospect.

Description

technical field [0001] The invention belongs to the technical field of preparation of phage nano-probes, in particular to M13 phage nano-probes and a preparation method thereof, in particular to gene modification of M13 phages and assembly with metal nanoparticles to form M13 phage nano-probes and preparation methods thereof. Background technique [0002] Based on the editability of the M13 phage genome, its five coat proteins (P3, P6, P8, P7, P9) can be used to display foreign peptides or antibodies. George P. Smith first proposed phage display technology in 1985. He successfully introduced foreign DNA into M13 and won the 2018 Nobel Prize in Chemistry for his phage display technology. [0003] Over the years, M13 phage has attracted extensive attention of researchers, and phage display technology has been widely used in the fields of immunology, pharmacology and drug discovery. After the specific antibodies, peptides or other molecules screened by phage display library ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/33C12N7/01
CPCC12N15/63C07K14/005C07K7/00C12N2795/14121
Inventor周昕侯金秀钱雪佳
OwnerYANGZHOU UNIV