M13 bacteriophage nanoprobe and preparation method thereof
A nano-probe and phage technology, applied in phage, virus/phage, botanical equipment and methods, etc., can solve the problems of low biological safety, long reaction time, poor monodispersity, etc., and achieve high collision efficiency and long binding time Short, good monodisperse effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] Example 1: Taking Affinity Porcine Epidemic Diarrhea Virus (PEDV) and Gold Nanoparticle Probe as an Example to Construct M13KO7 Phage Nanoprobe
[0066] 1. Transformation of the helper phage M13KO7 of the affinity virus: use M13KO7 as a primer design template, design a primer with the base sequence (GCGGGGTGGTATTGTACGGAGGTGTTGTGTGTTCAG) of the affinity PEDV polypeptide (AGWYCTEVLCVQ) as the homology arm primer, and insert the affinity PEDV polypeptide sequence into the P3 protein Between the end of the signal peptide and the first amino acid (Table 1, primers F1, R2, F3, R3 underlined part is the base sequence of the affinity PEDV polypeptide). Using M13KO7 as the template for amplification, using high-fidelity enzymes High-Fidelity 2×Master Mix for PCR amplification. Analysis of the amplified product by 1% agarose gel electrophoresis showed that the target fragment was not amplified by using primers F1 and R1, F2 and R2; fragment 1 containing the base sequence of the...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


