Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

52 results about "M13 bacteriophage" patented technology

M13 is a filamentous bacteriophage composed of circular single-stranded DNA (ssDNA) which is 6407 nucleotides long encapsulated in approximately 2700 copies of the major coat protein P8, and capped with 5 copies of two different minor coat proteins (P9, P6, P3) on the ends. The minor coat protein P3 attaches to the receptor at the tip of the F pilus of the host Escherichia coli. Infection with M13 lysogenic phage. The infection causes turbid plaques in E. coli lawns, of intermediary opacity in comparison to regular lysis plaques. However, a decrease in the rate of cell growth is seen in the infected cells. M13 plasmids are used for many recombinant DNA processes, and the virus has also used for phage display, nanostructures and nanotechnology applications.

Inorganic nanowires

InactiveUS20050221083A1Good monodispersityHigh degreeMaterial nanotechnologyNanoinformaticsNanowireSingle crystal
An inorganic nanowire having an organic scaffold substantially removed from the inorganic nanowire, the inorganic nanowire consisting essentially of fused inorganic nanoparticles substantially free of the organic scaffold, and methods of making same. For example, a virus-based scaffold for the synthesis of single crystal ZnS, CdS and free-standing L10 CoPt and FePt nanowires can be used, with the means of modifying substrate specificity through standard biological methods. Peptides can be selected through an evolutionary screening process that exhibit control of composition, size, and phase during nanoparticle nucleation have been expressed on the highly ordered filamentous capsid of the M13 bacteriophage. The incorporation of specific, nucleating peptides into the generic scaffold of the M13 coat structure can provide a viable template for the directed synthesis of a variety of materials including semiconducting and magnetic materials. Removal of the viral template via annealing can promote oriented aggregation-based crystal growth, forming individual crystalline nanowires. The unique ability to interchange substrate specific peptides into the linear self-assembled filamentous construct of the M13 virus introduces a material tunability not seen in previous synthetic routes. Therefore, this system provides a genetic tool kit for growing and organizing nanowires from various materials including semiconducting and magnetic materials.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST +1

Inorganic nanowires

InactiveUS7923109B2High degreeHigh of of modificationMaterial nanotechnologyNanoinformaticsNanowireSingle crystal
An inorganic nanowire having an organic scaffold substantially removed from the inorganic nanowire, the inorganic nanowire consisting essentially of fused inorganic nanoparticles substantially free of the organic scaffold, and methods of making same. For example, a virus-based scaffold for the synthesis of single crystal ZnS, CdS and free-standing L10 CoPt and FePt nanowires can be used, with the means of modifying substrate specificity through standard biological methods. Peptides can be selected through an evolutionary screening process that exhibit control of composition, size, and phase during nanoparticle nucleation have been expressed on the highly ordered filamentous capsid of the M13 bacteriophage. The incorporation of specific, nucleating peptides into the generic scaffold of the M13 coat structure can provide a viable template for the directed synthesis of a variety of materials including semiconducting and magnetic materials. Removal of the viral template via annealing can promote oriented aggregation-based crystal growth, forming individual crystalline nanowires. The unique ability to interchange substrate specific peptides into the linear self-assembled filamentous construct of the M13 virus introduces a material tunability not seen in previous synthetic routes. Therefore, this system provides a genetic tool kit for growing and organizing nanowires from various materials including semiconducting and magnetic materials.
Owner:BOARD OF RGT THE UNIV OF TEXAS SYST +1

Method of reducing cadmium ions by M13 phage-mediated nano-iron

The invention discloses a method of reducing cadmium ions by M13 phage-mediated nano-iron and belongs to the field of environmental pollution governance and nano material preparation. According to the method, iron-adsorbed special M13 phage is adopted to synthesize uniformly dispersed zero-valent nano-iron particles in a mediated manner, and adopts cadmium-adsorbed special M13 phage M13 (Cd-s) to uniformly disperse divalent cadmium ions; then, the zero-valent nano-iron mediated and dispersed by the M13 phage is taken as a reducing agent so as to efficiently reduce divalent cadmium ions uniformly dispersed on the surface of M13(Cd-s). The method disclosed by the invention is high in reducing efficiency, quick in reaction, capable of efficiently catalyzing the divalent ions to be reduced into zero-valent cadmium on the phage surface, so that cadnimum pollution in environment is removed, and nano-particles of zero-valent iron, iron oxide and zero-valent cadmium also can be quickly prepared.
Owner:TSINGHUA UNIV

DNA origami structure, closing and releasing method of DNA origami structure and application of DNA origami structure as drug delivery system

The invention relates to a DNA origami structure, a closing and releasing method of the DNA origami structure and an application of the DNA origami structure as a drug delivery system, and belongs tothe technical field of DNA nano drug delivery. The DNA origami structure is a DNA tetrahedron and comprises three side triangular origamis and a central triangular origami, and three sides of the central triangular origami are connected with the three side triangular origamis respectively; skeleton chains of the central triangular origami and the side triangular origamis are annular single-helix DNA chains of M13 bacteriophage; the central triangular origami and the side triangular origamis are occluded through base complementary pairing of respective internal staple chains and respective skeleton chains; the central triangular origami is complementarily paired with connecting staple chains of the side triangular origamis through a connecting staple chain; and the central triangular origami and the side triangular origamis capture nano-gold particles through capture chains, and the side triangular origamis and the central triangular origami form a three-dimensional tetrahedral origamistructure through traction of the nano-gold particles. According to the invention, the drug loading efficiency is improved.
Owner:HUAZHONG UNIV OF SCI & TECH

Method for preparing PD-L1 (programmed death-ligand 1) nanoantibody by immunizing alpacas with PD-L1 antigen

The invention belongs to the technical field of antibodies and discloses a method for preparing PD-L1 (programmed death-ligand 1) nanoantibody by immunizing alpacas with a PD-L1 antigen. The method comprises: designing two synthetic primers, amplifying by PCR (polymerase chain reaction) to obtain sufficient target products for enzyme digestion, linking target fragments to a vector, converting, and carrying out screening and cloning; carrying out protein verifying and expressing; constructing an antibody library; displaying a VHH antibody library through an M13 bacteriophage display system which is composed of a pMECS phagemid vector, E. coli TG1 and an M13KO7 helper phage. In the phasmid vector pMECS, a sequence before a Pst I enzyme digestion site is a coding sequence for part of amino acids in first frame regions of pelB secretory signal peptides and antibodies; the pelB signal peptides can guide subsequent polypeptides secreted to periplasmic cavities; a sequence after a Not I enzyme digestion site is a coding sequence for HA and 6*His tags; the method is suitable for purification or detection of fusion proteins.
Owner:SHIHEZI UNIVERSITY

Electrode composite material, preparation method thereof, anode possessing the electrode composite material and cell

ActiveCN104377350AInhibition of the shuttle effectInhibition lossMaterial nanotechnologyCell electrodesSulfurElectrochemistry
The invention provides an electrode composite material, which comprises M13 bacteriophage and elemental sulfur. The electrode composite material has good thermal stability and good electrochemistry performance, the problem of active material loss during charge and discharge process of cell can be effectively solved, and discharge capacity of the cell is increased. The invention also provides a preparation method of the electrode composite material, an anode possessing the electrode composite material and a cell.
Owner:POSITEC POWER TOOLS (SUZHOU) CO LTD +1

Electrode composite material, preparation method of electrode composite material, as well as negative electrode and battery with electrode composite material

The invention provides an electrode composite material which comprises a M13 bacteriophage and Mn3O4. The electrode composite material has a good nano structure and a good electrochemical performance, and can be used as a negative electrode material of a lithium ion battery; moreover, a preparation method of the electrode composite material is simple and feasible, and can be implemented at low temperature. The invention also provides the preparation method of an electrode composite material, and a negative electrode and a battery which comprise the electrode composite material.
Owner:POSITEC POWER TOOLS (SUZHOU) CO LTD +1

Preparation method of RGD-M13 bacteriophage/oxidized regenerated cellulose composite hemostatic material

The invention discloses a preparation method of a RGD-M13 bacteriophage / oxidized regenerated cellulose composite hemostatic material, and relates to a preparation method of a hemostatic material. The invention aims to solve the problems that in the prior art, after the modification of conventional oxidized regenerated cellulose, the hemostatic time is slightly prolonged, while the mechanical strength and biological absorbability of oxidized regenerated cellulose are both reduced. The preparation method comprises the following steps: step one, activating oxidized regenerated cellulose; step two, soaking the activated oxidized regenerated cellulose in RGD-M13 bacteriophage suspension so as to obtain the RGD-M13 bacteriophage / oxidized regenerated cellulose composite hemostatic material. The prepared RGD-M13 bacteriophage / oxidized regenerated cellulose composite hemostatic material can be used to stop bleeding, and hemostatic time is shortened by 10.4 to 32.9%. The provided prepared method can obtain a RGD-M13 bacteriophage / oxidized regenerated cellulose composite hemostatic material.
Owner:HARBIN INST OF TECH

Recombinant phages

InactiveUS6497874B1Kill bacteriaBiocidePeptide/protein ingredientsEtiologyBacteroides
Owner:M ANG RDH SVEN

Preparation method of RGD-M13 phage/polylysine/oxidized regenerated cellulose composite haemostatic material

ActiveCN105477675AGood hemostatic effectNo damage to mechanical strengthPharmaceutical delivery mechanismAbsorbent padsPolymer sciencePolyphage
The invention discloses a preparation method of an RGD-M13 phage / polylysine / oxidized regenerated cellulose composite haemostatic material, and relates to a preparation method of a haemostatic material. The invention aims at solving the problems of an existing oxidized regenerated cellulose modified haemostatic material that a haemostatic time is lightly improved, and the mechanical strength and bio-absorbing property of the oxidized regenerated cellulose are decreased. The method comprises the following steps: I. self-assembly of polylysine; II. self-assembly of an RGD-M13 phage; and III. cleaning and drying, so that the RGD-M13 phage / polylysine / oxidized regenerated cellulose composite haemostatic material is obtained. The RGD-M13 phage / polylysine / oxidized regenerated cellulose composite haemostatic material prepared by the invention, when applied to haemostasis, can shorten the haemostatic time by 25.17%-41.95%. The invention provides the RGD-M13 phage / polylysine / oxidized regenerated cellulose composite haemostatic material.
Owner:HARBIN INST OF TECH

Modified ITO electrode for improving electricity production efficiency of electricity producing bacteria and preparation method thereof

The invention discloses a modified ITO electrode for improving electricity production efficiency of electricity producing bacteria and a preparation method thereof. The method comprises the following steps: reacting the amine group on a protein shell of M13 bacteriophage with ferrocene formaldehyde for connection, and uniformly coating the surface of ITO; assembling a three-electrode reactor and conducting electrochemical parameters scanning by an electrochemical workstation; and using the modified electrode as a working electrode, Ag / AgCl as a reference electrode and platinum wire as a negative electrode. In this environment, the electron transfer efficiency and capacity of the electricity producing bacteria can be accelerated. The electrode modification method is more simple and feasible compared to gene reconstruction on electricity producing bacteria for improvement of electricity producing capability, and has good development space.
Owner:SOUTHEAST UNIV

Method for rapidly screening bacterial quorum sensing inhibitor (QSI) by utilizing luminescence method

ActiveCN105504001AEliminate blind selection of materialsEliminate cumbersome processing stepsPeptide preparation methodsEscherichia coliAmpicillin
The invention provides a method for rapidly screening a bacterial quorum sensing inhibitor (QSI) by utilizing a luminescence method. The method is characterized by infecting escherichia coli ER2738 carrying pSB536 by utilizing the characteristic that a phage M13 does not lyse a host bacterium and can be secreted outside cells and then screening a bacterial clone which is blue under visible light and does not emit or emits weak biological fluorescent light under exciting light in a plate to which a C4-AHL molecule, tetracycline, ampicillin and X-gal / IPTG are added; then amplifying the phage, carrying out streak culture in the plate to which the substances are added, verifying the functions of the QSI by a method of inhibiting bioluminescence and finally obtaining specific QSI polypeptide sequences through sequencing. The method is simple in steps, and multiple QSI candidate polypeptides can be obtained only within three days to about one weak, so that the method has very obvious advantages.
Owner:FUJIAN AGRI & FORESTRY UNIV

Novel micro-environment biological macromolecule general oscillator as well as synthesis method and application thereof

The invention discloses a novel micro-environment biological macromolecule oscillator. The oscillator relies on DNA origami, uses single-stranded-base genes of a M13 phage as a skeleton, uses more than 100 kinds of single-stranded oligonucleotide primers to fold skeleton nucleic acid into a stable trigeminy clip structure, and combines with the affinity of aptamer on biological macromolecules, the closing and opening of clips can dynamically capture and release free proteins to achieve a regulatory function of the concentration of micro-environment biological macromolecules. The opening and closing state of an outer clip and a middle clip are always different. When the oscillator adjusts the concentration of a pair of macromolecules with antagonistic functions, the metabolic reaction rate and the reaction direction can be controlled. The structure of a DNA device is observed by an atomic force microscope, and the ability to regulate and control protein molecules is demonstrated by experiments such as in vitro blood coagulation.
Owner:HUAZHONG UNIV OF SCI & TECH

Method for directly counting H9N2 avian influenza virus by naked eyes

PendingCN110187114ATiter accurate quantificationEasy to operateBiological material analysisNanoparticleAvian influenza virus
The invention discloses an M13@GNP indicator probe and a preparation method thereof, wherein the M13@GNP indicator probe is a protein G-coated gold nanoparticle combined with an M13 monoclonal antibody and a H9N2 monoclonal antibody, and then combined with the M13 phage. The invention also discloses a method for directly counting H9N2 avian influenza virus by naked eyes. The object of the invention is to establish a detection method for directly counting H9N2 influenza virus based on phage@gold nanoprobe, which can detect and quantify H9N2 influenza virus in a sample, shorten the detection period, simplify the detection process, improve the universal applicability of detection methods and is conducive to on-site inspection, so that the detection of H9N2 influenza virus is accurate, sensitive and simple, and timely prevention and control is of great significance.
Owner:YANGZHOU UNIV

Bacteriophage electrochemical luminescence signal amplification probe and preparation method and application thereof

The invention discloses a bacteriophage electrochemical luminescence signal amplification probe and a preparation method and application thereof. The bacteriophage electrochemical luminescence signal amplification probe comprises M13 bacteriophage, streptavidin expressed in the M13 bacteriophage in a fusion manner and tris-(bipyridyl) ruthenium which is covalently connected to the M13 bacteriophage. According to the bacteriophage electrochemical luminescence signal amplification probe, the M13 bacteriophage is used as a connecting skeletion for amplifying tris-(bipyridyl) ruthenium signals, and has the advantages of stable system, difficulty in gathering, easiness in storage and the like. The prepared signal amplification probe has the advantages of simplicity, controllability, high signal amplification efficiency and the like, and can be used for quantitative detection of nucleic acid or antigen and the like.
Owner:广州博徕斯生物科技股份有限公司

Tetrahedral framework nucleic acid and preparation method therefor

Provided are a tetrahedral framework nucleic acid and a preparation method therefor. Escherichia coli is used as a host to produce an M13 bacteriophage so as to obtain single-stranded DNA (ssDNA) in the M13 bacteriophage, ssDNA required for assembling the tetrahedral framework nucleic acid is obtained by cleavage with restriction endonuclease II, and then the tetrahedral framework nucleic acid is obtained by self-assembly of the ssDNA. The production costs of TDN are reduced while achieving large-scale industrial production of the TDN, and the present invention has good practicability.
Owner:CHANGZHOU ZHISHENG BIOTECHNOLOGY CO LTD

Recombinant M13 bacteriophage, K88 targeting antibacterial preparation containing bacteriophage and application of K88 targeting antibacterial preparation

The invention discloses a recombinant M13 bacteriophage, a K88 targeting antibacterial preparation containing the bacteriophage and application of the K88 targeting antibacterial preparation, and belongs to the field of biotechnology and veterinary medicine. The antibacterial preparation comprises a recombinant M13 bacteriophage rM13; a K88 targeting element is displayed on a tail filament pIII protein of the recombinant M13 bacteriophage, and the K88 targeting element is a nano antibody NBK88 of which the amino acid sequence is as shown in SEQ ID NO: 1. Through engineering modification, the rM13 can specifically recognize, infect and split enterotoxigenic escherichia coli expressing K88 fimbriae, so that the host range of the wild type M13 is accurately guided to pathogenic bacteria. The invention also provides application of the preparation in preparation of medicines for preventing or treating ETEC infection, and the dosage form of the preparation is preferably a freeze-dried preparation or an enteric-coated preparation capable of being released in a targeted intestinal tract. The preparation provided by the invention has the remarkable advantages of strong targeting property, self-proliferation, no damage to intestinal microecology and capability of overcoming bacterial drug resistance.
Owner:DALIAN UNIV OF TECH +1

Genetically engineered bacteriophage hydrogel for fat ablation treatment as well as preparation method and application of genetically engineered bacteriophage hydrogel

PendingCN121628849AAerosol deliveryVirus peptidesBAX ProteinPro-Apoptotic Proteins
The invention relates to the technical field of bacteriophages, and particularly discloses a genetically engineered bacteriophage hydrogel for fat ablation therapy and a preparation method and application of the genetically engineered bacteriophage hydrogel for fat ablation therapy, and the genetically engineered M13 bacteriophage is formed by inserting an adipocyte targeting sequence ATS into a gene VIII of the M13 bacteriophage, a coding gene of pro-apoptotic protein Bax is integrated in a genome of the M13 bacteriophage; the nucleotide sequence of the adipocyte targeting sequence ATS is TGTAAAGGTGGCCGTGCTAAAGACTGT, the expression level of pro-apoptotic protein Bax in adipocytes of a treatment group is remarkably improved through hydrogel constructed through the M13-ATS-Bax bacteriophage, experiments prove that the constructed M13-ATS-Bax bacteriophage can be combined with the adipocytes in a targeting mode and efficiently express the Bax protein, and the expression level of the pro-apoptotic protein Bax is remarkably improved. The compound formed by the hydrogel has a remarkable effect of killing fat cells.
Owner:REHABILITATION UNIVERSITY QINGDAO CENTRAL HOSPITAL

Dual-targeting broad-spectrum chimeric bacteriophage antibacterial drug preparation as well as preparation method and application thereof

The invention belongs to the technical field of biological medicines, and particularly relates to a dual-targeting broad-spectrum chimeric bacteriophage antibacterial pharmaceutical preparation as well as a preparation method and application thereof. The antibacterial drug preparation comprises a bioactive substance and a liposome for coating the bioactive substance, the bioactive substance is a targeting chimeric M13 bacteriophage coupled with an antibacterial substance, and the surface of the liposome is coupled with a targeting antibody. According to the invention, the liposome and bacteriophage dual-targeting design is adopted, specific targeting to bacterial focuses can be realized, and the antibacterial substance is loaded on the mild M13 bacteriophage, so that the dosage of the antibacterial substance is reduced, and meanwhile, uncontrollable release of endotoxin is avoided; and finally, the intracellular and extracellular bacteria at the in-vivo focus are thoroughly killed under the cooperation of the liposome with the targeting capability and the customizable chimeric bacteriophage.
Owner:HUAZHONG UNIV OF SCI & TECH

Double-channel constant-temperature detection primer, probe, kit, method and application of epidermis-adridyvirus

The invention belongs to the technical field of virus detection, and particularly relates to a nucleic acid detection primer, a probe, a detection kit, a detection method and application of an immature skin-adding virus. The primer, the probe and the reaction system designed by the invention are high in sensitivity, the lowest detection limit can reach 3 copies / mL, the accuracy is 100%, the specificity is high, and cross amplification with other 76 pathogens is avoided. The kit adopts a recombinase polymerase isothermal amplification technology, does not need a large-scale PCR instrument, can complete detection only in 25 minutes, saves about 2 hours of time compared with a traditional fluorescent PCR detection method, adopts an M13 bacteriophage probe as internal positive quality control, can prevent false negative conditions, and can prevent pollution by adding UNG enzyme. The kit can be used for laboratory detection, field detection and bedside detection, and is especially suitable for detection of the yearly skin-adding virus at quarantine ports, airports and epidemic disease outbreak sites.
Owner:TONGJI HOSPITAL ATTACHED TO TONGJI MEDICAL COLLEGE HUAZHONG SCI TECH

Micro-electrolysis system and its preparation method and application

ActiveCN105645528BWater/sewage treatmentReduction ratePotential difference
The invention provides a microelectrolysis system as well as a preparation method and an application thereof. The microelectrolysis system comprises bacteriophage M13, first metal and second metal, wherein the first metal and the second metal are distributed on the surface of the bacteriophage M13 and have a potential difference. The first metal and the second metal have the potential difference, so that the microelectrolysis system can be formed effectively and can be used for performing reductive treatment on organic pollutants or heavy metal ions in sewage, the reduction rate is high, required time is short, treatment can be performed at normal temperature and normal pressure, and the microelectrolysis system does not need a noble metal catalyst and is lower in cost.
Owner:TSINGHUA UNIV

Defense peptides against fungal infection and method of their use

InactiveUS20110271400A1High expressionHigh recovery rateFungiBacteriaBiotechnologyAsian soybean rust
Phakopsora pachyrhizi, the fungal pathogen that causes Asian soybean rust, has the potential to cause significant losses in soybean yield in many production regions of the U.S. To assist the development of new modes of soybean resistance to fungal infection, peptides were identified from combinatorial phage-display peptide libraries which inhibit germ tube growth from urediniospores of P. pachyrhizi. Two peptides, Sp2 and Sp39, were identified that inhibit germ tube development when displayed as fusions with the coat protein of M13 phage or as fusions with maize cytokinin oxidase / dehydrogenase (ZmCKX1). These peptides may be used in vitro to help control fungal infection. These peptides may also be expressed as transgenes in a plant to help the resulting transgenic plant defend against the fungi
Owner:UNIVERSITY OF MISSOURI

M13 bacteriophages displaying peptide motifs targeting amyloid-beta, methods and uses thereof

The present disclosure relates to an engineered M13 bacteriophage displaying amyloidogenic peptide motifs from amyloid beta 42 (Aβ42) at its surface. The present disclosure further relates to the use of the disclosed engineered M13 bacteriophage for detecting early species of Aβ, namely oligomeric and fibrillar Aβ, and preventing its aggregation promoting the inhibition of the progression of Alzheimer's disease and thus contributing to the treatment of this neurodegenerative disorder.
Owner:UNIVERSITY OF MINHO +1

A recombinant m13 bacteriophage, a k88-targeting antibacterial preparation comprising the same, and use thereof

The application discloses a recombinant M13 bacteriophage, a K88-targeting antibacterial preparation containing the bacteriophage and application of the antibacterial preparation, and belongs to the field of biotechnology and veterinary medicine. The antibacterial preparation contains the recombinant M13 bacteriophage rM13; a K88-targeting element is displayed on the tail fiber pIII protein of the recombinant M13 bacteriophage, and the K88-targeting element is a nanobody NBK88 with an amino acid sequence shown in SEQ ID NO:1. The engineering in the application enables the rM13 to specifically recognize, invade and lyse enterotoxigenic Escherichia coli expressing K88 fimbriae, so that the host range of the wild-type M13 is accurately guided to pathogenic bacteria. The application also provides use of the preparation in preparation of a medicine for preventing or treating ETEC infection, and a dosage form of the medicine is preferably a freeze-dried preparation or an enteric preparation capable of releasing in the intestinal tract. The preparation provided by the application has the advantages of high targeting, self-proliferation, non-damage to intestinal microecology and overcoming of bacterial drug resistance.
Owner:DALIAN UNIV OF TECH +1

Phage multifunctional affinity interface as well as preparation method and application thereof

The invention discloses a phage multifunctional affinity interface as well as a preparation method and application thereof, and belongs to the field of functional biological materials. The preparation method of the phage multifunctional affinity interface comprises the following steps: modifying a phenylboronic acid group by using pVIII protein on the side wall of an M13 phage as a bracket; connecting histidine on the protein of the M13 bacteriophage pIII to the nickel magnetic microbead; the method comprises the following steps: carrying out fluorescence labeling on a biotinylated aptamer targeting EpCAM positive cells, hybridizing with a complementary chain of a labeled fluorescence quencher, and coupling with avidin according to a molar ratio of 4: 1 to obtain an avidin-biotinylated DNA switch; and then the M13 bacteriophage-nickel magnetic microbead containing the phenylboronic acid group is coupled with an avidin-biotinylated DNA (Deoxyribose Nucleic Acid) switch. The capture efficiency of the multifunctional affinity interface to MCF-7 cells reaches 94.2%, the release efficiency reaches 92.7%, and the multifunctional affinity interface has reproducibility and can be used for multiple rounds of cell separation.
Owner:NORTHEASTERN UNIV CHINA