Application of polyinosinic acid in preparation of biological agent for improving response level of HBsAg positive mother infant hepatitis B vaccines

A technology of polyinosinic acid and biological preparations, applied in the field of biological preparations, can solve problems affecting children's immune response, hepatitis B vaccine no/weak response, etc.

Pending Publication Date: 2021-09-17
SHANXI MEDICAL UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the previous study, the applicant found that the expression of TLR3 mRNA and protein in the placenta of HBsAg-positive mothers decreased compared with normal mothers by detecting the placental tissue of HBsAg-positive mothers after delivery, suggesting

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of polyinosinic acid in preparation of biological agent for improving response level of HBsAg positive mother infant hepatitis B vaccines
  • Application of polyinosinic acid in preparation of biological agent for improving response level of HBsAg positive mother infant hepatitis B vaccines
  • Application of polyinosinic acid in preparation of biological agent for improving response level of HBsAg positive mother infant hepatitis B vaccines

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Population studies

[0030] A total of 399 pairs of HBsAg-positive mothers and their newborns were consecutively collected as research subjects. All newborns completed standard hepatitis B passive-active immunization prevention and were followed up to 1 year ± 1 month. Before delivery, 3 mL of non-anticoagulated cubital vein of pregnant women was collected, and placental tissue was collected within 30 minutes after delivery; newborns were injected with hepatitis B immune globulin and hepatitis B vaccine within 24 hours of birth and 6 days after completion of standard passive-active immunization of hepatitis B. ± 1 month (infant 1 year ± 1 month) to collect 3mL of non-anticoagulated femoral vein. Conduct the following research:

[0031] (1) Fluorescence quantitative polymerase chain reaction (Fluorescence Quantitative polymerase Chain Reaction, FQ-PCR) was used to detect the serum HBV DNA content of HBsAg-positive mothers and their infants. Specifically, the hepatiti...

Embodiment 2

[0048] In vitro experiments

[0049] (1) The normal human trophoblast cell line (HTR8-Svneo cells) was cultured in vitro and stimulated with HBV positive serum to simulate the effect of the special intrauterine environment of HBsAg positive mothers on placental trophoblast cells. FQ-PCR was used to detect HBV DNA in HTR8-Svneo cells (the method was the same as that described in Example 1, and lg conversion was performed when the detection results of intracellular HBV DNA (IU / ml) were statistically processed); fluorescence quantitative reverse transcription polymerase chain reaction ( Fluorescence Quantitative ReverseTranscription-polymerase Chain Reaction, RT-qPCR) detected the mRNA content of important signaling molecules in the TLR3 signaling pathway after HTR8-SVneo cells were infected with HBV. The specific primers used are as follows:

[0050] TLR3 upstream primer TGATGCTCCGAAGGGTGG (SEQ ID NO: 1);

[0051] Downstream primer GCCGTGCTAAGTTGTTATGCTG (SEQ ID NO: 2);

[00...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides application of polyinosinic acid in preparation of a biological agent for improving the response level of HBsAg positive mother infant hepatitis B vaccines, and belongs to the technical field of biological agents. The invention discloses application of polyinosinic acid in preparation of a biological agent for improving the response level of HBsAg positive mother infant hepatitis B vaccines. HBeAg of an HBsAg positive mother inhibits a TLR3 signal channel, and placenta immunity is influenced to reduce the immune level of an infant, so that no/weak response of a hepatitis B vaccine is caused. The polyinosinic acid activates a trophoblast cell TLR3 signal channel to increase secretion of IL-2, increase the proportion of CD4 + T cells in PBMC, reduce the proportion of Treg cells and improve the immune level of the body, and rHBsAg stimulation can improve the expression quantity of IL-6 and the proportion of myelodendritic cells (mDC), reduce the expression of IL-10 and improve the anti-HBs level.Therefore, therefore the polyinosinic acid is beneficial to improving the response level of the body to the hepatitis B vaccines.

Description

technical field [0001] The invention belongs to the technical field of biological preparations, in particular to the application of polyinosinic acid (PolyI:C) in the preparation of biological preparations for improving the response level of hepatitis B vaccine of HBsAg positive mothers and infants. Background technique [0002] Hepatitis B virus (HBV) infection is a major global public health problem. Hepatitis B vaccine is an effective means to prevent HBV infection. The carrier rate of HBsAg) has dropped by 3%, and the achievements have attracted worldwide attention, but the positive rate of HBsAg in my country is still 6.1%. Infants of HBsAg-positive mothers have a high rate of non- / weak response to hepatitis B vaccine (18.5%-40%), are prone to HBV infection, and nearly 90% of perinatal HBV-infected patients will develop chronic HBV infection. 15%-25% of them die from HBV infection-related diseases. HBV infection of HBsAg-positive mothers and infants has become the main r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K39/39A61K39/29A61K45/06A61P13/12A61P1/16A61P31/20
CPCA61K39/39A61K39/12A61K45/06A61P13/12A61P1/16A61P31/20C12N2730/10134A61K2039/55583
Inventor 冯永亮武丽娜王素萍李雁笛扆琳珠晋聪陈文鑫王婷
Owner SHANXI MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap