Check patentability & draft patents in minutes with Patsnap Eureka AI!

Biological sample nucleic acid release preservative

A nucleic acid release and biological sample technology, applied in the field of molecular biology, can solve the problems of long-term preservation of nucleic acid, cumbersome operation, and inability to directly amplify

Pending Publication Date: 2021-10-01
JIANGSU GENESTONE BIO-TECH CO LTD
View PDF8 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The above technical solutions cannot directly perform PCR amplification, and traditional nucleic acid purification is required, which is cumbersome to operate
[0009] In summary, there are obviously obvious defects and inconveniences in the actual use of the existing technical solutions. Direct amplification can be achieved but nucleic acid cannot be stored for a long time, and nucleic acid can be stored for a long time but cannot be directly amplified, so it is necessary to improve

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Biological sample nucleic acid release preservative
  • Biological sample nucleic acid release preservative
  • Biological sample nucleic acid release preservative

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1: Nucleic acid detection of β-actin in human buccal swabs.

[0031] 1. The detection method includes the following steps.

[0032] step one.

[0033] Take a person's oral swab, put the swab directly into 1ml of the sample release agent, turn it upside down several times, and discard the swab after the color of the reagent changes from grape purple to orange-green to obtain a mixed solution.

[0034] step two.

[0035] Take 2 μl, 4 μl and 8 μl of processed samples to configure the qPCR system, and do three parallel experiments for each volume of samples. The fam channel detects human β-actin mRNA. The primer design (human β-actin mRNA detection primers and probes Needle: HB-FCGAGCACAGAGCCTCGC; HB-R CATCATCCATGGTGAGCTGG; HB-P FAM-ATCCGCCGCCCGTCCA-MGB) are spanning intronic primers, which can only specifically amplify human β-actin mRNA, but cannot amplify its coding DNA.

[0036] Second, PCR amplification.

[0037] The detection equipment is ABI 7500, and the r...

Embodiment 2

[0040] Example 2: Human oral swabs The test results of the storage of nucleic acids released from human oral swabs at room temperature (25°C) and in refrigerators (2°C-8°C).

[0041] step one.

[0042] Take oral swabs (sample A, sample B, sample C) of three different people, put the swabs of different samples directly into different 1ml release agents of this sample, turn them upside down several times until the color of the reagent changes from grape purple Discard the swab after it turns orange-green to obtain a mixed solution. Divide each sample into two equal parts, one at room temperature (25°C), and the other in a refrigerator at 2-8°C.

[0043] step two.

[0044] Perform PCR detection on the first day, the second day, the third day until the 15th day according to step 2 of Example 1 and the PCR amplification method.

[0045] 3. Experimental results.

[0046] See Figure 2, Figure 3, Figure 4 , it can be seen that there is not much difference between the preservation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a biological sample nucleic acid release preservative, which belongs to the technical field of molecular biology, and discloses a method which can split common detection samples, can be directly used for downstream PCR detection or high-throughput sequencing and can stably preserve sample nucleic acid released after splitting for a long time. The preservation agent comprises Tween20 (0.01%-10%, V / V), glycogen (2-500 ng / mu l), formamide (2-500 ng / mu l), artificially synthesized 25 nt poly A (2-500 ng / mu l), potassium hydroxide (0.01 mM-50 mM) and cresol red (0.01%-10%, mass / volume), a solvent is nuclease-free water. By means of the method, quality control can be conducted on a PCR system through naked eyes, consumed time is short, efficiency is high, operation is easy and convenient, production cost is low, preservation time is long, and the preservation agent has great market popularization value.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and specifically relates to a new type of preservative that can be directly used for detection without subsequent nucleic acid extraction, and can store nucleic acid (including DNA and RNA) released after lysis for a long-term stable storage Agents and preparation methods. Background technique [0002] Nucleic acid refers to the general term of deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). It is a biological macromolecular polymer polymerized by many nucleotide monomers. The essential constituent substances are the most important substances in all biomolecules, and are widely present in all animal and plant cells and microorganisms. Nucleic acid is composed of nucleotides, and nucleotide monomers are composed of five-carbon sugars, phosphate groups and containing Nitrogen bases; if the five-carbon sugar is ribose, the polymer formed is RNA; if the five-carbon sugar is deoxyri...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/24
CPCC12Q1/24
Inventor 王珺飞李文天
Owner JIANGSU GENESTONE BIO-TECH CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More