Unlock instant, AI-driven research and patent intelligence for your innovation.

Protein for regulating pressure stress resistance of cronobacter sakazakii, and coding gene and application thereof

A technology with strong pressure resistance and bacilli, which is applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as no related reports, achieve broad application prospects, reduce integrity, and achieve good killing effects

Active Publication Date: 2021-10-19
HEFEI UNIV OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to its dense biofilm structure, Kronobacter sakazakii has good stability to high pressure stimulation, so if a functional gene that can regulate the biofilm structure of Kronobacter sakazakii is found, it can control the The tolerance of Rhinobacter to pressure, which has important practical significance for high-pressure sterilization, has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein for regulating pressure stress resistance of cronobacter sakazakii, and coding gene and application thereof
  • Protein for regulating pressure stress resistance of cronobacter sakazakii, and coding gene and application thereof
  • Protein for regulating pressure stress resistance of cronobacter sakazakii, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Discovery of Differential Expression of CpxA Gene of Cronobacter sakazakii

[0042]5mL of adjusted concentration of Cronobacter sakazakii suspension (about 10 8 CFU / mL) into 10mL polyethylene plastic bags, packaged and sealed, and subjected to 10min ultra-high pressure treatment under the conditions of 50MPa and 400MPa. The statistical enrichment of differentially expressed genes in the KEGG pathway was then analyzed using KOBAS software. It was found that the two-component system (Two-componentsystem) was differentially expressed after 50MPa treatment, see Figure 1A . The q-PCR verification of the differentially expressed genes of Cronobacter sakazakii under 400MPa ultra-high pressure conditions shows that under the condition of 400Mpa, the cpxA gene expressing histidine kinase in the Cpx two-component regulatory system of Cronobacter sakazakii Transcript levels are downregulated, see Figure 1B , indicating that under high-pressure environmental stress, ...

Embodiment 2

[0043] Cloning of embodiment 2 Cronobacter sakazakii CpxA gene

[0044] The genomic DNA of Cronobacter sakazakii was extracted as a template, and the following primers were designed according to the genomic sequence of the target gene:

[0045] The forward primer is cpxAF: AGGGCACGATGATTGAGCA

[0046] The reverse primer is cpxAR: CTGACCGATAAAGTTGCGAATG

[0047] After sequencing, the PCR amplification product of Cronobacter sakazakii CpxA has the nucleotide sequence shown in SEQ ID No:1.

Embodiment 3

[0048] Example 3 Construction of Cronobacter sakazakii mutant ΔCpxA

[0049] The following primers were designed according to the genomic DNA sequence of Cronobacter sakazakii:

[0050] ATCC-TF: GTCCCTGTTAAAGGAATTGCTCG

[0051] ATCC-TR: ATCAGCATTTCAACGGCATCA

[0052] ATCC-MF1: GGAATCTAGACCTTGAGTCGTTGCTCGACGTGATGATGCC

[0053] ATCC-MR1: GTGATAAAGCGGCAACCAGAGCCAGAAAATGGCGAAGATGC

[0054] ATCC-MF2: GCATCTTCGCCATTTTCTGGCTCTGGTTGCCGCTTTATCAC

[0055] ATCC-MR2: ACAGCTAGCGACGATATGTCTTTGTTGTTTCTGACGGTGGC

[0056] pLP-UF: GACACAGTTGTAACTGGTCCA

[0057] pLP-UR: CAGGAACACTTAACGGCTGAC

[0058] ATCC-MF1 / ATCC-MR1 and ATCC-MF2 / ATCC-MR2 were used to amplify, respectively, to obtain ATCC upstream homology arm A fragment and ATCC downstream homology arm B fragment. Then use the above A and B fragments as templates to perform overlapping PCR amplification to obtain the fusion AB fragment, see Figure 2A . The AB purified fragment was connected with the suicide vector pLP12cm, and the re...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein for regulating pressure stress resistance of cronobacter sakazakii, and a coding gene and application thereof. The gene has a sequence as shown in SEQ ID NO: 2. The high-pressure-resistant gene CpxA of the cronobacter sakazakii is knocked out by utilizing a gene engineering technology, so that the expression of histidine kinase in the high-pressure-resistant gene CpxA is remarkably reduced, the integrity of a cell membrane of the cronobacter sakazakii is further remarkably reduced, the compression resistance of the cronobacter sakazakii is greatly weakened, and the protein not only can effectively inhibit the formation of a cronobacter sakazakii pellicle, but also can achieve a good cronobacter sakazakii killing effect under a low pressure, and has a wide application prospect in the fields of food safety and the like.

Description

technical field [0001] The invention specifically relates to a protein for regulating the stress tolerance of Cronobacter sakazakii, its coding gene and application, and belongs to the technical field of bioengineering. Background technique [0002] With the rapid development of science and technology, there are more and more types of food, which brings great challenges to food safety - the increase in the types of food-borne pathogenic bacteria poses a problem for the sterilization technology commonly used in the food industry today. [0003] Cronobacter sakazakii is a highly pathogenic food-borne Enterobacter, which belongs to the Enterobacteriaceae, a facultative anaerobic Gram-negative bacillus that lives in the intestinal tract of humans and animals. Most cases of its infection are infants and young children, mainly causing bacteremia, meningitis, necrotizing enterocolitis, etc., and the fatality rate is as high as 40%-80%. This is because Cronobacter sakazakii mainly ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/31C12N15/74C12N1/21C07K14/195C12R1/01
CPCC07K14/195C12N15/74Y02A50/30
Inventor 汪惠丽陶晗徐毅朱雪峰廖巧明夏颜舟
Owner HEFEI UNIV OF TECH