Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A protein regulating Cronobacter sakazakii's stress tolerance, its encoding gene and application

A pressure-resistant and bacilli-resistant technology, applied in the fields of application, genetic engineering, and plant genetic improvement, can solve problems such as no related reports, achieve broad application prospects, reduce integrity, and achieve good killing effects

Active Publication Date: 2022-07-12
HEFEI UNIV OF TECH
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Due to its dense biofilm structure, Kronobacter sakazakii has good stability to high pressure stimulation, so if a functional gene that can regulate the biofilm structure of Kronobacter sakazakii is found, it can control the The tolerance of Rhinobacter to pressure, which has important practical significance for high-pressure sterilization, has not been reported so far

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A protein regulating Cronobacter sakazakii's stress tolerance, its encoding gene and application
  • A protein regulating Cronobacter sakazakii's stress tolerance, its encoding gene and application
  • A protein regulating Cronobacter sakazakii's stress tolerance, its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1 Discovery of differential expression of CpxA gene of Cronobacter sakazakii

[0042]5 mL of the adjusted concentration of Cronobacter sakazakii bacteria suspension (about 10 8 CFU / mL) was divided into 10mL polyethylene plastic bags, packaged and sealed, and subjected to ultra-high pressure treatment for 10min under the conditions of 50MPa and 400MPa. The statistical enrichment of differentially expressed genes in the KEGG pathway was then analyzed using KOBAS software. It was found that the two-component system was differentially expressed after 50MPa treatment, see Figure 1A . The differentially expressed genes of Cronobacter sakazakii under 400MPa ultra-high pressure were verified by q-PCR. It can be seen that under the condition of 400Mpa, the cpxA gene expressing histidine kinase in the Cronobacter sakazakii Cpx two-component regulatory system Transcriptional levels are downregulated, see Figure 1B , indicating that under high pressure environmental st...

Embodiment 2

[0043] Example 2 Cloning of Cronobacter sakazakii CpxA gene

[0044] The genomic DNA of Cronobacter sakazakii was extracted as a template, and the following primers were designed according to the genomic sequence of the target gene:

[0045] Forward primer is cpxAF: AGGGCACGATGATTGAGCA

[0046] The reverse primer is cpxAR: CTGACCGATAAAGTTGCGAATG

[0047] After sequencing, the PCR amplification product of Cronobacter sakazakii CpxA has the nucleotide sequence shown in SEQ ID No: 1.

Embodiment 3

[0048] Example 3 Construction of Cronobacter sakazakii mutant ΔCpxA

[0049] The following primers were designed based on the genomic DNA sequence of Cronobacter sakazakii:

[0050] ATCC-TF: GTCCCTGTTAAAGGAATTGCTCG

[0051] ATCC-TR: ATCAGCATTTCAACGGCATCA

[0052] ATCC-MF1: GGAATCTAGACCTTGAGTCGTTGCTCGACGTGATGATGCC

[0053] ATCC-MR1: GTGATAAAGCGGCAACCAGAGCCAGAAAATGGCGAAGATGC

[0054] ATCC-MF2: GCATCTTCGCCATTTTCTGGCTCTGGTTGCCGCTTTATCAC

[0055] ATCC-MR2: ACAGCTAGCGACGATATGTCTTTGTTGTTTCTGACGGTGGC

[0056] pLP-UF:GACACAGTTGTAACTGGTCCA

[0057] pLP-UR: CAGGAACACTTAACGGCTGAC

[0058] Amplify with ATCC-MF1 / ATCC-MR1 and ATCC-MF2 / ATCC-MR2 respectively to obtain ATCC upstream homology arm A fragment and ATCC downstream homology arm B fragment. Then take the above-mentioned A and B fragments as templates, carry out overlapping PCR amplification to obtain fusion AB fragments, refer to Figure 2A . The AB purified fragment was ligated with the suicide vector pLP12cm, and the recomb...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a protein for regulating Cronobacter sakazakii's resistance to high stress, its encoding gene and application. The gene has the sequence shown in SEQ ID NO:2. The invention uses genetic engineering technology to knock out the high pressure resistance gene CpxA of Cronobacter sakazakii, so that the expression of histidine kinase in it is significantly reduced, thereby significantly reducing the integrity of the cell membrane of Cronobacter sakazakii, so that the sakazakii The anti-stress performance of Cronobacter sakazakii is greatly weakened, which can not only effectively inhibit the formation of Cronobacter sakazakii biofilm, but also achieve better killing effect of Cronobacter sakazakii under lower pressure. There are broad application prospects in other fields.

Description

technical field [0001] The invention specifically relates to a protein for regulating Cronobacter sakazakii's resistance to high pressure stress, its encoding gene and application, and belongs to the technical field of bioengineering. Background technique [0002] With the rapid development of science and technology, there are more and more types of food, which brings great challenges to food safety. [0003] Cronobacter sakazakii is a highly pathogenic food-borne Enterobacter. The bacteria of this genus are facultative anaerobic gram-negative bacilli living in the intestinal tract of humans and animals, belonging to the family Enterobacteriaceae. Most cases of its infection are infants and young children, mainly causing bacteremia, meningitis, necrotizing enterocolitis, etc., and the fatality rate is as high as 40%-80%. This is because Cronobacter sakazakii is mainly found in infant formula, but Cronobacter sakazakii can also be detected in other infant food products. Due...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/74C12N1/21C07K14/195C12R1/01
CPCC07K14/195C12N15/74Y02A50/30
Inventor 汪惠丽陶晗徐毅朱雪峰廖巧明夏颜舟
Owner HEFEI UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com