Lotus corniculatus LcMYB5 gene and application thereof

A lotus root and gene technology, applied in the field of genetic engineering, can solve the problems of unclear molecular mechanism and hinder the breeding work of leaf tannin content, so as to increase the tannin content, reduce economic losses, and slow down the effect of bloat disease

Active Publication Date: 2021-11-05
INST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are few studies on the synthesis of leaf tannins in japonicus japonicus. Only in 1983, Ross et al. conducted a population analysis on the leaf tannins of nearly 200 different japonicus japonicus varieties, and found that the content of tannins in the leaves was polymorphic. And it is controlled by single-gene dominant inheritance, but the gene has not been studied in depth
Therefore, the molecular mechanism of leaf tannin biosynthesis in J. japonicus remains unclear, hampering further breeding efforts to increase leaf tannin content through genetic improvement.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lotus corniculatus LcMYB5 gene and application thereof
  • Lotus corniculatus LcMYB5 gene and application thereof
  • Lotus corniculatus LcMYB5 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] By collecting 38 lotus corniculatus L. germplasm resources, the tannin content in the leaves was quantitatively determined. It was found that the tannin content in leaves per gram of dry weight ranged from the lowest 0 mg to the highest 88.4 mg, as figure 1 shown. The diversity of tannin content in the leaves of these germplasm resources laid the foundation for the identification of key regulatory genes for tannin synthesis in japonicus japonicus leaves.

[0034] Meanwhile, since japonicus japonicus is diploid, its genome has also been revealed, and it has been widely used as a model plant for research. Lotus japonicus L. and Lotus corniculatus L. are also closely related. Therefore, the study also analyzed the distribution pattern of tannins in japonicus japonicus, and found that in leaves, stems and roots of japonicus japonicus, almost no accumulation of tannins was detected; a small amount of tannins was also found in flowers, Tannin is mainly concentrated in the ...

Embodiment 2

[0037] The LcMYB5 gene was cloned from the leaves of the plant material with the highest tannin content (B91). Six genome sequences of the LcMYB5 gene were cloned, namely LcMYB5A, LcMYB5B, LcMYB5C, LcMYB5D, LcMYB5E and LcMYB5F (the underlined ones are intron sequences, and the others are coding region sequences).

[0038] LcMYB5A:

[0039] ATGAGGAACCCGATAGCATCATCATCAACGAACAAGAAGAAGAGCAGTACTACAACTGGTAATGAAAATGGCACGACTGTTACTACTACTCCGTGCTGCAGCAAAGTTGGGTTGAAGAGAGGGCCATGGACACCGGAGGAAGACGAGGTGTTGGCCAGTTTCATAAGGAAAGAAGGCGAAGGTCGCTGGAGAACGCTTCCAAAAAGAGCCGGCCTCCTCCGCTGCGGTAAGAGCTGCCGCCTCCGCTGGATGAACTACCTCCGCCCCTCCGTCAAACGCGGCCAGATCGCCCCCGACGAGGAAGATCTCATCCTCCGCCTTCACCGCCTCCTCGGCAACCG GTACCTTTCTCCTCGATCGATCTTCCTTTT ATCTAGCTTAGGGTTTGCTACGAACTTTGCTTAACTAATTAATTAATTTTAAATAAACATATATATAGCTAGGG CTTGATTTAATTACACTTTATTTAATTACCATTTCATCAATCATGTTTAGGATATAGTACAACAAATTCATTTTGAA ACTAACATTAATTCTAGCAAGAAGCTTTCTTAAATAGCTTCTGGGTGTTAAAATTGATTCTGATGTTACATTTACA G GTGGTCTTTGATAGCGGGAAGAATTCCGGGAAGAAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a lotus corniculatus LcMYB5 gene. A nucleotide sequence of the lotus corniculatus LcMYB5 gene is selected from at least one of sequences as shown in SEQ ID No: 3-8. The invention further provides application of the lotus corniculatus LcMYB5 gene in improvement on the tannin content of plant leaves. According to the invention, the new key regulatory gene LcMYB5 for regulating tannin biosynthesis in lotus corniculatus is identified for the first time. The lotus corniculatus LcMYB5 gene provides a new candidate gene for cultivating forage grass varieties with high-content tannin in leaves, and provides a new way for cultivating new forage grass varieties with anti-tympanites quality; the gene can be used for further genetic improvement to increase the leaf tannin content in lotus corniculatus; the gene can also be used for carrying out genetic improvement on forage grass without accumulation of tannin on leaves or with low tannin content to increase the tannin content so as to prevent or slow down the tympanites, thereby reducing the economic loss.

Description

technical field [0001] The invention relates to LcMYB5 gene of japonicus japonicus and application thereof, in particular to application of LcMYB5 gene of japonicus japonicus in regulating tannin content, and belongs to the technical field of genetic engineering application. Background technique [0002] Tannins (Proanthocyanidins) are flavonoid secondary metabolites with important activities in plants. It not only plays an important role in the regulation of seed dormancy, lifespan and germination, but also participates in the regulation of biotic and abiotic stresses in plants. In animal husbandry, tannins in pasture can also inhibit the growth of rumen methanogens in ruminants, reduce the release of methane, inhibit the growth of gastrointestinal parasites, improve animal fertility, and promote fetal development, wool production and lactation. Appropriate amount Tannins are also effective in preventing the often fatal bloat disease in ruminants such as cattle and sheep. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/84A01H5/12A01H6/82A01H6/54
CPCC07K14/415C12N15/8243C12N15/8205
Inventor江文波庞永珍
OwnerINST OF ANIMAL SCI OF CHINESE ACAD OF AGRI SCI