Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Indirect ELISA method of clostridium perfringens beta1 toxin antibody

A technology of Clostridium perfringens and toxin, which is applied in the direction of measuring devices, instruments, scientific instruments, etc., can solve the problem of lack of detection products of toxin, and achieve the effect of strong specificity, good stability and good stability

Pending Publication Date: 2021-11-26
NINGXIA UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is still a lack of relevant detection products for the detection of this toxin, and there is an urgent need for an easy-to-operate, high-sensitivity, specificity, stable and reliable method for the epidemiological investigation of Clostridium perfringens in farm animals Therefore, it is very necessary to establish an indirect ELISA detection method for the monoclonal antibody of the perfringer shuttle β1 toxin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect ELISA method of clostridium perfringens beta1 toxin antibody
  • Indirect ELISA method of clostridium perfringens beta1 toxin antibody
  • Indirect ELISA method of clostridium perfringens beta1 toxin antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1: Expression of soluble recombinant Clostridium perfringens β1 toxin protein:

[0053] According to the sequence of Clostridium perfringens β1 toxin gene reported in the literature, design primers

[0054] Forward(5`-3`)CGGAATTCCATATGGATATAGGCAAAACTACTACTAT

[0055] Reverse(5`-3`)GAATGCGGCCGCAATAGCTGTTACTTTATG

[0056] The cpb1 gene was amplified from the C-type standard strain of Clostridium perfringens, constructed into pTIG-Trx vector, transformed into BL21(DE3) strain, and labeled as BL21(DE3)pTIG-cpb1.

[0057] Take the BL21(DE3)pTIG-cpb1 glycerol frozen strain, streak it on the LB solid plate containing 100 μg / mL ampicillin, pick a single colony the next day and insert it into 10 mL LB liquid medium containing 100 μg / mL ampicillin for culture When the OD600 of the bacterial solution reaches above 1.0, inoculate 1% inoculum in 200 mL LB liquid medium containing 100 μg / mL ampicillin and culture for 3 hours, then induce expression at 20 °C and 0.5 mM IPTG ...

Embodiment 2

[0058] Example 2: Purification of soluble recombinant Clostridium perfringens β1 toxin protein:

[0059] Centrifuge to collect 800mL of recombinant expression cells after induction, wash once with PBS, add 20mM Tris-HCL (pH 8.0) buffer to resuspend 10mL of cell pellet, add 100μg / mL lysozyme, 1‰ TritonX-100, 0.01mM PMSF, Sonicate for 10min; centrifuge at 10,000rmp for 10min, take the precipitate and wash it once with 10mL of 20mM Tris-HCL (pH 8.0) buffer containing 0.2M urea; pH 8.0) denaturing buffer, incubate at 37°C for 2 hours to completely dissolve and denature the precipitate; transfer the dissolved and denatured protein solution to the dialysis bag, and add 150 mL of urea to the liquid outside the dialysis bag in sequence with a concentration gradient of 1.5M and 1M respectively , 0.5M, 0M 20mM Tris-HCL (pH 8.0) refolding buffer, each concentration gradient treatment for 6h.

Embodiment 3

[0060] Example 3: Determination of Coating Conditions for Soluble Clostridium perfringens β1 Toxin Protein Antigen:

[0061] Using the matrix titration method, the β1 toxin recombinant protein was used as the coating antigen, and the β1 toxin recombinant protein was diluted with the coating buffer, and the concentrations in each well were 2 μg / mL, 5 μg / mL, 8 μg / mL, and 10 μg / mL. Dilute in mL, add 100 μL to each well of the microtiter plate, and coat overnight at 4°C; use 5% skimmed milk powder, use purified McAb1K19 as the primary antibody, HRP-goat anti-mouse IgG as the secondary antibody, OPD as the chromogenic solution, 2M H 2 SO 4 The solution is the stop solution, and the absorbance value is detected by measuring the OD450nm value.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an indirect ELISA (enzyme-linked immuno sorbent assay) detection method for a clostridium perfringens beta 1 toxin antibody. The indirect ELISA detection method comprises the following steps: step 1, establishing an indirect ELISA method for the clostridium perfringens beta 1 toxin antibody; and step 2, determining a result judgment standard. The invention belongs to the technical field of pathogenic microorganism detection, and particularly provides an indirect ELISA system for detecting a clostridium perfringens beta 1 toxin antibody, which has good specificity, high sensitivity and good repeatability, and provides an effective detection means for the clostridium perfringens infection condition of animals. The indirect ELISA detection method for the clostridium perfringens beta 1 toxin antibody has a wide application prospect in the aspects of clinical serum epidemiological investigation and vaccine immune effect evaluation, and can be used for rapidly detecting the clostridium perfringens beta 1 toxin antibody.

Description

technical field [0001] The invention belongs to the technical field of pathogenic microorganism detection, and specifically refers to an indirect ELISA detection method for Clostridium perfringens β1 toxin antibody. Background technique [0002] Clostridium perfringens (C.perfringens), also known as Clostridium welchii (C.welchii), is an opportunistic pathogen that parasitizes in the gastrointestinal tract of humans and animals under normal conditions. Clostridium perfringens is divided into five subtypes A, B, C, D, and E according to the four main exotoxins (α, β, ε, ι) secreted by it. [0003] Clostridium perfringens (Clostridium perfringens) is an important zoonotic pathogen, which can cause enterotoxemia, gas gangrene, necrotic enteritis and even death in humans and various animals. The disease of livestock occurs rapidly in a short period of time. If it cannot be diagnosed and treated in time, it will often cause shock and even death. β1 toxin is produced by Clostrid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/577G01N33/569
CPCG01N33/577G01N33/56911
Inventor 马臣杰曾瑾马玲玲李勇宋孚洋刘晓明马红梅吴霜马嘉琦王东李文
Owner NINGXIA UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com