LAMP-LFD visual detection primer group for detecting melia azedarach leaf shrinkage virus and detection method
A technology of LAMP-LFD and detection method is applied in the field of LAMP-LFD visual detection primer set for detecting neem leaf shrink virus, and achieves the effects of convenient and fast amplification time, high accuracy and strong specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Design of primer set for detection of neem leaf shrinkage virus LAMP-LFD
[0043] 1. Extraction of neem leaf shrinkage virus genomic DNA:
[0044](1) Using the CTAB method to extract Neem leaf shrinkage virus genomic DNA, the specific steps are as follows: 30 minutes in advance, heat the CTAB extract (2×) in a 65°C water bath, grind the freeze-dried sample into powder with liquid nitrogen, and transfer it to Add 800μl preheated CTAB to a 1.5mL centrifuge tube, mix well, and keep at 65°C for 30min-60min. Centrifuge again at 12000r / min at room temperature for 10min, and discard the precipitate. Finally, add phenol: chloroform: isoamyl alcohol (25:24:1) equal in volume to the supernatant after centrifugation, mix well, place in a fume hood for 15 min, then centrifuge at room temperature for 10 min at 12000 r / min (there is stratification in the tube, the supernatant Nucleic acid in the middle, protein layer in the middle, and impurities at the bottom). Carefully pipette ...
example 2
[0060] Optimization of each reaction condition of LAMP of the present invention
[0061] 1. Optimization of LAMP reaction system:
[0062] Using the primer set of the present invention, the LAMP reaction system was optimized multiple times, and finally the optimal concentration of each component in the reaction system was determined to be MgSO 4 10mmol / L, dNTP Mix 1.4mmol / L, inner primer CLSV-FIP, CLSV-BIP each 1.6μmol / L, outer primer CLSV-F3, CLSV-B3 each 0.2μmol / L, loop primer CLSV-LB 0.4μmol / L , 8000 U Bst2.0 DNA polymerase 0.5 μL. MgSO 4 , dNTP concentration optimization results see figure 1 and figure 2 .
[0063] 2. LAMP reaction temperature optimization:
[0064] According to the optimized system, set a temperature gradient of 50°C-70°C on the PCR instrument (the gradients are: 50°C, 51.4°C, 53.8°C, 57.5°C, 60°C, 65.9°C, 68.5°C, 70°C), set Blank control. The amplified product was subjected to agarose gel electrophoresis, and after the amplification of the Neem...
Embodiment 3
[0070] Use the LAMP-LFD technology of the present invention to carry out the detection of neem leaf shrinkage virus to plant blind samples
[0071] Take nine unknown samples and use CLSV-specific primers
[0072] CLSV-d1-F: GAGAATGATGTATCCCACGG;
[0073] CLSV-d1-R:CCTGATCCTGAATATGTGTTGT.
[0074] Carry out PCR amplification on the sample, the target band size is 143bp, in order to carry out agarose gel electrophoresis for the amplification result, set a blank control, the result is as follows Figure 8 As shown, 1#, 4#, 8#, and 9# are virus-positive samples. Carry out LAMP-LFD visual detection of the present invention to nine unknown samples again, set blank control, the result is as follows Figure 9 shown. 1#, 4#, 8#, and 9# were also obtained as positive results. Experiments have proved that the primer set of the present invention has higher accuracy rate against neem leaf shrinkage virus.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More