16 results about "Melia azedarach" patented technology

The invention belongs to the field of molecular biology, and particularly relates to an ITS molecular marker primer and method for identifying a melia azedarach lingering variety and application of the ITS molecular marker primer and method. The ITS molecular marker primer comprises the following components: ITS-p5, CCTTATCAYTTAGAGGAAGGAG, and ITS-u4, RGTTTCTTTCCTCCGCTTA, and is characterized in that the ITS-p5, the CCTTATCAYTTAGAGGAAGGAG The identification method comprises the following steps: collecting a molecular specimen; extracting DNA (deoxyribonucleic acid); according to the present invention, primers ITS-p5 and ITS-u4 are adopted to perform ITS fragment amplification, sequencing is performed, and if the 56th site to the 71st site in the 5 '-3' direction in the ITS sequences of different species of the chinaberry tree, the variety with the 16-base deletion of CGCGGGGCGGGCGA is the honeydew lingering variety; the invention also discloses an application of the ITS molecular marker primer in a reagent and a kit. According to the method, the ITS sequences of different species can be directly and accurately identified, the defects of traditional morphological identification are effectively overcome, the value of a new Honeysuckle variety in the fields of ecological restoration, economic material development, medicinal resource development and the like is fully exerted, and large-scale high-quality development of the melia azedarach industry is assisted.

The present application relates to toothpaste technical field, specifically, it relates to the bacteriostatic oral care toothpaste based on active ingredient of mountain ardisia. It includes sorbitol, hydrated silicon stone, deionized water, polyethylene glycol-8, sodium lauryl sulfate, essence, polyquaternium-22, cellulose glue, sodium saccharin, hydroxypropyl guar gum, sodium methyl hydroxybenzoate and mountain ardisia extract;The bacteriostatic oral care toothpaste based on active ingredient of mountain ardisia, by introducing the mountain ardisia extract with specific chemical composition into the formula system, effectively solve the problem that the existing oral care product is not strong in specificity to periodontal pathogenic bacteria, and the bacteriostatic spectrum is relatively single;The mutual synergistic effect relationship exists between the extract, not only broaden the inhibition spectrum of periodontal pathogenic microorganism, also can reduce the oxidative stress and inflammatory response of gingival tissue, thereby maintaining oral cleaning, improve the comprehensive performance of oral care product and the mildness of use.

The invention discloses an emulsified cutting fluid using a plant extract as a bactericide. The emulsified cutting fluid is prepared from the following raw materials in parts by weight: 15-28 parts of base oil 1, 25-28 parts of base oil 2, 8-16 parts of an oil-soluble antirust agent, 10-19 parts of an emulsifier, 0.0-0.6 part of an antioxidant, 2-4 parts of an emulsion stabilizer and 3-5 parts of the plant extract bactericide, the base oil 1 is 150SN or transformer oil, the base oil 2 is naphthenic mineral oil, and the plant extract bactericide is a mixture of malus hupehensis extract, wolf thorn extract and melia azedarach extract. The special plant extract bactericide can effectively inhibit bacteria, fungi and anaerobic bacteria, has a broad-spectrum bactericidal effect, has good compatibility and emulsification stability, does not produce layering, turbidity and foam, does not destroy the uniformity and lubrication performance of the cutting fluid, can significantly reduce the skin irritation risk when workers contact the cutting fluid, and has a good application prospect. And the biodegradability is good, the biodegradability is easy to decompose by microorganisms in the natural environment, and the goal of'zero emission 'is favorably realized.

The invention discloses a botanical fungicide for metal working fluid, which is prepared from the following raw materials in parts by weight: malus hupehensis extract, wolf thorn extract and melia azedarach extract according to the mass ratio of 1: (2-4): (2-4). The bactericide is natural in raw materials, can effectively inhibit bacteria, fungi and anaerobic bacteria, has a broad-spectrum bactericidal effect, is good in stability, can effectively avoid the problem of spoilage of the metal working fluid, is good in compatibility with the metal working fluid, is not liable to generate a precipitation reaction with other additives in the working fluid, is not liable to generate drug resistance, and is safe and reliable. The skin irritation risk when workers make contact with the disinfectant can be remarkably reduced, the disinfectant has good biodegradability, is easily decomposed by microorganisms in the natural environment, does not leave lasting chemical residues like traditional bactericides, and is beneficial to achieving the zero emission target.

1. Name of the designed product: sofa (white blank of Melia azedarach). 2. Use of the designed product: for people to rest. 3. Design points of the designed product: in shape. 4. Picture or photo best showing the design points: perspective view. 5. Part of the designed product not easily seen or not seen when in use is omitted, and the top view is omitted.

This invention relates to the field of Mongolian medicine preparation technology, and discloses an Erdun-7 granule preparation and its preparation method, which is made from the following raw materials in parts by weight: 1 part of *Inula japonica* and 1.3-1.8 parts of *Rubus idaeus*, used to regulate qi, relieve exterior symptoms and reduce fever; 1.6-2.4 parts of *Sophora flavescens*, 0.7-1.3 parts of *Gardenia jasminoides*, and 0.7-1.3 parts of *Terminalia chebula*, used to enhance the heat-clearing, fire-purging, detoxifying and blood-cooling effects of *Inula japonica* and *Rubus idaeus*; 0.8-1.2 parts of *Uncaria rhynchophylla* and 0.8-1.2 parts of *Cicada slough*, used to calm the liver, extinguish wind, and stop spasms; and 0.7-1.3 parts of *Kaempferia galanga* and 0.7-1.3 parts of *Melia azedarach*. This Erdun-7 granule preparation and its preparation method target the anticonvulsant effect of the granules, prolonging the latency period and reducing the incidence and severity, which is significantly better than traditional preparations, demonstrating the synergistic effect of clearing heat and relieving exterior symptoms and extinguishing wind and stopping spasms.

The invention belongs to the field of daily chemicals, and particularly relates to a cleaning, anti-dandruff and hair-care composition containing melia azedarach seed oil, which comprises the following components by weight: 1-5% of melia azedarach seed oil; 0.5-2% of a radix sophorae flavescentis extract; 1-30% of a surfactant; 0.1 to 4% of a cationic conditioner; 1-5% of a humectant; and the balance deionized water. The melia azedarach seed oil is matched with the radix sophorae flavescentis extract, and the melia azedarach seed oil and the radix sophorae flavescentis extract have a synergistic effect, so that the anti-dandruff and anti-inflammatory repair effects are very good. The melia azedarach seed oil is matched with the radix sophorae flavescentis extract, so that on one hand, the micro-ecological environment of scalp water-oil balance can be adjusted, the scalp micro-ecology is improved, and the anti-dandruff, antibacterial and anti-inflammatory capacities of the composition are improved; on the other hand, the effects of resisting oxidation, moisturizing, caring, nourishing and moistening the hair can be achieved together, so that the undesirable phenomena that the hair is dry, frizzy, tangled, split, prone to breakage and the like are reduced, the damaged, dry and oxidized matt hair is repaired, the smoothness and toughness of the hair are enhanced, and the health state of scalp and the hair is improved.

The invention discloses a metal processing synthetic fluid using a plant extract as a bactericide. The metal processing synthetic fluid comprises the following raw materials: deionized water, ethanolamine, binary acid, boric acid, sodium hydroxide, dimer acid, dodecenylsuccinic acid, tall oil, sodium thiosulfate, sodium methyl cellulose and the plant extract bactericide. The plant extract bactericide is a mixture of malus hupehensis extract, wolf thorn extract and melia azedarach extract; the metal working fluid has the advantages that the efficient control on microorganisms in the metal working fluid is realized, bacteria, fungi and anaerobic bacteria can be effectively inhibited, the broad-spectrum bactericidal effect is realized, the compatibility is very good, the stability is good, the reaction with a lubricant or an anti-rust agent is avoided, the precipitation or floating oil is not generated, and the uniformity and the lubricating property of the metal working synthetic fluid are not damaged; according to the present invention, the skin irritation risk during the contact with the worker can be significantly reduced, and the product has good biodegradability, can be easily decomposed by microorganisms in the natural environment, and can easily achieve the zero emission target.

The invention discloses a treatment device and a treatment method for ichthyophthiriasis of largemouth bass, and belongs to the technical field of aquaculture. The device comprises a treatment bin, a filtering bin and a medicine bin, a disinfecting and killing device is further arranged between the filtering bin and the medicine bin, and all the components cooperate to achieve water circulation, temperature control, salinity adjustment, medicine mixing and disinfecting and filtering. During treatment, the temperature of a water body is stable, the salinity is accurately adjusted through the salt adding box, the salinity is adjusted from high salinity to low salinity, then melia azedarach oil and eucalyptus oil with specific dosage are matched to kill ichthyophthirius multifiliis, and then povidone iodine is used for disinfection and vitamin C is used for assisting recovery. The method solves the problems of large drug dosage, high energy consumption, inaccurate salinity adjustment and easy disease recurrence in the prior art, has the advantages of drug and energy consumption saving, accurate salinity adjustment, thorough treatment and simple and convenient operation, and is suitable for efficient treatment of industrial largemouth bass ichthyophthiriasis.

The invention belongs to the field of molecular biology, and particularly relates to primers and a method for identifying SNP molecular markers of a melia azedarach lingering variety and application of the primers and the method for identifying the SNP molecular markers of the melia azedarach lingering variety. According to the present invention, the primers comprise an SNP (single nucleotide polymorphism)-F: GATTTGAACCTATACCAAAGG, and an SNP-R: GCATCGCTGAATTGAATACG, the identification method comprises the following steps: collecting a molecular specimen; extracting DNA (deoxyribonucleic acid); after the primers SNP-F and SNP-R are used for carrying out SNP fragment amplification, electrophoresis, screening and sequencing, the obtained SNP fragments are sequenced, and if single base mutation exists at the 33rd site in the 5 '-3' direction in the SNP sequence, the variety of which C is mutated into A is honeydew lingering. The invention also discloses an application of the primer required by the SNP molecular marker in a reagent and a kit. According to the method, accurate identification can be directly realized on the basis of mononucleotide variation, and the defects of traditional morphological identification are effectively overcome, so that a new variety of Honeylocust can fully exert the value of the new variety in the fields of ecological restoration, economic material development, medicinal resource development and the like, and large-scale high-quality development of the melia azedarach industry is assisted.

This invention provides a polysaccharide from *Melia azedarach*, its extraction method, and its applications, belonging to the field of polysaccharide extraction technology. The *Melia azedarach* polysaccharide includes at least one of *Melia azedarach* polysaccharide 1 and *Melia azedarach* polysaccharide 2. *Melia azedarach* polysaccharide 1 comprises the polysaccharide molecule represented by formula (I), and *Melia azedarach* polysaccharide 2 comprises the polysaccharide molecule represented by formula (II). This invention also provides a method for extracting this *Melia azedarach* polysaccharide. This *Melia azedarach* polysaccharide exhibits good effects in fat binding, bile acid binding, cholesterol binding, and lipase inhibition, and has broad application prospects in the preparation of lipid-lowering products.

The present application belongs to the technical field of pet medicine, and particularly relates to a traditional Chinese medicine composition and traditional Chinese medicine preparation for external use on pet skin, and a preparation method and application thereof. The traditional Chinese medicine raw materials contained in the traditional Chinese medicine composition of the present application include: Sophora flavescens, Stachys, Cnidium, Dictamnus dasycarpus, Taraxacum mongolicum, Phellodendron, Portulaca oleracea, Semen Haloxylon, and Melia azedarach. On the basis of years of clinical work experience and professional knowledge, the present application successfully obtains a traditional Chinese medicine composition and traditional Chinese medicine preparation for treating pet skin diseases. The traditional Chinese medicine composition of the present application is simple in prescription, reasonable in compatibility, safe and environmentally friendly, natural and hormone-free, and safe and reliable in use.

This invention provides a topical herbal patch for postpartum acute mastitis and its preparation method, belonging to the field of traditional Chinese medicine pharmaceutical technology. The patch is composed of *Paris polyphylla*, *Vaccaria segetalis*, *Uncaria rhynchophylla*, *Bombyx mori*, *Mild Glauber's salt*, processed *Evodia rutaecarpa*, *Citrus aurantium*, *Cirsium japonicum*, *Smilax china*, *Siegesbeckia orientalis*, stir-fried *Melia azedarach*, and licorice. Based on a rigorous formula of principal, assistant, and adjuvant herbs, this patch significantly reduces serum TNF-α, IL-1β, and IL-6 levels in mice with postpartum mastitis, and significantly improves the overall clinical efficacy. It rapidly relieves core symptoms such as breast redness, swelling, pain, and induration, clears milk stasis, and possesses multiple effects including anti-inflammatory, anti-swelling, lactation-promoting, and analgesic properties. This herbal patch is a topical care preparation that acts directly on the affected area of ​​the breast. The drug is absorbed transdermally without gastrointestinal metabolism, and its components do not affect the infant through breast milk. This provides a safe, efficient, and convenient new topical care solution for postpartum acute mastitis.

The application discloses a forest management method for improving quality and efficiency of Chinese fir plantations, application and Chinese fir plantations, and the management method for improving quality and efficiency of Chinese fir plantations comprises the following steps: cutting part of trees in the Chinese fir forest, so that the remaining density of the existing stand is 100-1050 trees per hectare; planting valuable and native tree species in the gaps of the stand, and the number of the planted trees is 300-1260 trees per hectare; and the planted tree species are at least three of the following: Phoebe zhennan, Liquidambar formosana, Schima superba, Cinnamomum camphora, Cyclobalanopsis glauca, Taxus wallichiana, Ginkgo biloba, Machilus zuihoensis, Melia azedarach and Sapium rotundifolium. 2 2 2 2 The valuable and native tree species are selected according to the local conditions, and the different-age, multi-layer and mixed stands are cultivated, the valuable timber is reserved, and the management purpose of improving quality and efficiency of the Chinese fir plantations is achieved.​​​

The invention relates to the technical field of external ointment, in particular to turpinia arguta ointment and a preparation method thereof. The traditional Chinese medicine composition is mainly prepared from the following raw materials in parts by weight: 1-3 parts of turpinia arguta leaf extract; 8-12 parts of tea oil; 1-4 parts of camphor tree essential oil; 1-5 parts of natural beeswax; the total asiaticoside is strategically introduced into a traditional anti-inflammatory analgesic system composed of the turpinia arguta leaf extract, the tea oil, the camphor tree essential oil and the natural beewax, and the stability of active ingredients in the turpinia arguta ointment is improved through the preparation method, so that the turpinia arguta ointment has the instant effects of rapidly resisting bacteria and diminishing inflammation and relieving swelling and pain; the invention relates to a multifunctional external preparation which can be used for promoting fibroblast proliferation and collagen ordered synthesis, actively accelerating wound healing and remarkably inhibiting scar formation, so that on the premise of ensuring excellent storage stability and use safety, the function span from pure symptom control to active tissue repair is realized.

The invention discloses a plate with antibacterial and insect-repelling functions and a preparation method thereof. The board is a multi-layer composite board prepared by dipping veneers with Chinese herbal medicine extracts with antibacterial and insect-repelling effects and bonding and pressing the veneers. In the bonding and hot pressing processes of the board, no formaldehyde component is released, and the board has the antibacterial and insect-repelling effects. And in the plate steeping liquor, a humifuse euphorbia herb extract and a phyllanthus urinaria extract are combined, and a cortex meliae extract and a radix berberidis extract are combined, so that the antibacterial and parasite expelling effects of the plate are improved, and synergistic interaction is achieved.