Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

32 results about "Melia azedarach" patented technology

Melia azedarach, commonly known by many names, including chinaberry tree, Pride of India, bead-tree, Cape lilac, syringa berrytree, Persian lilac, and Indian lilac, is a species of deciduous tree in the mahogany family, Meliaceae, that is native to Indomalaya and Australasia.

Forest management method for improving quality and efficiency of man-made Chinese fir forest, application and man-made Chinese fir forest

The invention discloses a forest management method for improving quality and efficiency of a fir man-made forest, application and the fir man-made forest, and the forest management method for improving quality and efficiency of the fir man-made forest comprises the following steps: cutting off part of forests in the fir man-made forest to enable the retention density of the existing forest stand to be 100-1050 plants / hm < 2 >; precious and indigenous tree species are planted in forest stand gaps in a complementary mode, and the complementary plant number is 300 plants / hm < 2 > to 1260 plants / hm < 2 >; the complementary planting tree species are at least three of phoebe bournei, sweetgum, schima superba, camphor tree, cyclobalanopsis glauca, taxus chinensis var mairei, gingko, schima superba, mangnolia officinalis, melia azedarach and sapium discolor. According to the method, quality improvement / operation transformation measures such as stand density adjustment and tree species configuration regulation are carried out on the fir man-made forests in different age groups, precious and indigenous tree species are selected according to local conditions for complementary planting, different-age, multi-layer and mixed stand is cultivated, precious wood is stored, and the operation purpose of quality improvement and efficiency improvement of the fir man-made forests is achieved.
Owner:HUNAN PROSPECTING DESIGNING & RES INST FOR AGRI FORESTRY & IND +1

Saline-alkali soil improver as well as preparation and use methods thereof

The invention discloses a saline-alkali soil improver as well as a preparation method and a use method thereof. The saline-alkali soil improver is mainly prepared by mixing fly ash, dilute sulphuric acid, zeolite powder, sawdust, desulfurized gypsum / calcium phosphate, humic acid, a bio-organic fertilizer and a microbial fertilizer with water. The concentration of the dilute sulphuric acid is 1-3 mol / l; the saw dust does not comprise Chinese honeylocust tree saw dust and melia azedarach saw dust. The saline-alkali soil modifier is combined with irrigation and water conservancy engineering measures, crops are planted, the upper layer and the lower layer of saline-alkali soil jointly exert force, the concentration of harmful ions in the upper layer soil and the lower layer soil of the saline-alkali soil can be effectively reduced, the soil condition of the improved saline-alkali soil is close to the soil condition of a normal farmland, and the saline-alkali soil quality is improved. In addition, the saline-alkali soil improver can effectively improve the soil environment while improving the soil, and has important application value and significance compared with saline-alkali soil improvement technologies such as pure high polymer materials and the like.
Owner:SHANDONG AGRICULTURAL UNIVERSITY

ITS molecular marker primer and method for identifying melia azedarach lingering variety and application of ITS molecular marker primer

The invention belongs to the field of molecular biology, and particularly relates to an ITS molecular marker primer and method for identifying a melia azedarach lingering variety and application of the ITS molecular marker primer and method. The ITS molecular marker primer comprises the following components: ITS-p5, CCTTATCAYTTAGAGGAAGGAG, and ITS-u4, RGTTTCTTTCCTCCGCTTA, and is characterized in that the ITS-p5, the CCTTATCAYTTAGAGGAAGGAG The identification method comprises the following steps: collecting a molecular specimen; extracting DNA (deoxyribonucleic acid); according to the present invention, primers ITS-p5 and ITS-u4 are adopted to perform ITS fragment amplification, sequencing is performed, and if the 56th site to the 71st site in the 5 '-3' direction in the ITS sequences of different species of the chinaberry tree, the variety with the 16-base deletion of CGCGGGGCGGGCGA is the honeydew lingering variety; the invention also discloses an application of the ITS molecular marker primer in a reagent and a kit. According to the method, the ITS sequences of different species can be directly and accurately identified, the defects of traditional morphological identification are effectively overcome, the value of a new Honeysuckle variety in the fields of ecological restoration, economic material development, medicinal resource development and the like is fully exerted, and large-scale high-quality development of the melia azedarach industry is assisted.
Owner:SHIJIAZHUANG SHENZHOU FLOWER RES INST CO LTD +2

Culture method for increasing content of Antrodin C in antrodia camphorata mycelium

ActiveCN120424778AFungiMicroorganism based processesMyceliumAntrodin C
The invention provides a culture method for increasing the content of Antrodin C in antrodia camphorata mycelia, and relates to the technical field of edible and medicinal fungus production processes. The culture method comprises the following steps: inoculating antrodia camphorata mycelia into a PDA liquid culture medium added with melia azedarach tender leaf homogenate, and culturing in a constant-temperature shaking table at 28 + / -2 DEG C and 150 + / -50 rpm for 15-20 days. According to the method, the defects in the prior art are overcome, the content of Antrodin C in the Gaochaigong antrodia camphorata mycelia is increased by optimizing the formula of the fermentation culture medium and improving the fermentation conditions, and the pharmacological activity of the Gaochaigong antrodia camphorata mycelia is enhanced.
Owner:YUNNAN ACAD OF FORESTRY +1

A culture method for increasing the content of antrodin c in the mycelium of taiwanofungus camphoratus

The application provides a culture method for improving the content of Antrodin C in the mycelium of Antrodia cinnamomea, and relates to the technical field of edible and medicinal fungus production processes.The culture method is that the mycelium of Antrodia cinnamomea is inoculated into PDA liquid culture medium added with uniform homogenate of tender leaves of Melia azedarach, and is cultured in a constant-temperature shaking table at 28±2 DEG C and 150±50 rpm for 15-20 days.The application overcomes the defects of the prior art, improves the content of Antrodin C in the mycelium of Antrodia cinnamomea by optimizing the formula of the fermentation medium and improving the fermentation conditions, and strengthens the pharmacological activity of the mycelium of Antrodia cinnamomea.
Owner:YUNNAN ACAD OF FORESTRY +1

Antibacterial oral care toothpaste based on active ingredients of melia azedarach

PendingCN122376504ABiotechnologyMouth care
The present application relates to toothpaste technical field, specifically, it relates to the bacteriostatic oral care toothpaste based on active ingredient of mountain ardisia. It includes sorbitol, hydrated silicon stone, deionized water, polyethylene glycol-8, sodium lauryl sulfate, essence, polyquaternium-22, cellulose glue, sodium saccharin, hydroxypropyl guar gum, sodium methyl hydroxybenzoate and mountain ardisia extract;The bacteriostatic oral care toothpaste based on active ingredient of mountain ardisia, by introducing the mountain ardisia extract with specific chemical composition into the formula system, effectively solve the problem that the existing oral care product is not strong in specificity to periodontal pathogenic bacteria, and the bacteriostatic spectrum is relatively single;The mutual synergistic effect relationship exists between the extract, not only broaden the inhibition spectrum of periodontal pathogenic microorganism, also can reduce the oxidative stress and inflammatory response of gingival tissue, thereby maintaining oral cleaning, improve the comprehensive performance of oral care product and the mildness of use.
Owner:JIANGXI ACAD OF FORESTRY +1

Emulsion cutting fluid taking plant extract as bactericide and preparation method thereof

The invention discloses an emulsified cutting fluid using a plant extract as a bactericide. The emulsified cutting fluid is prepared from the following raw materials in parts by weight: 15-28 parts of base oil 1, 25-28 parts of base oil 2, 8-16 parts of an oil-soluble antirust agent, 10-19 parts of an emulsifier, 0.0-0.6 part of an antioxidant, 2-4 parts of an emulsion stabilizer and 3-5 parts of the plant extract bactericide, the base oil 1 is 150SN or transformer oil, the base oil 2 is naphthenic mineral oil, and the plant extract bactericide is a mixture of malus hupehensis extract, wolf thorn extract and melia azedarach extract. The special plant extract bactericide can effectively inhibit bacteria, fungi and anaerobic bacteria, has a broad-spectrum bactericidal effect, has good compatibility and emulsification stability, does not produce layering, turbidity and foam, does not destroy the uniformity and lubrication performance of the cutting fluid, can significantly reduce the skin irritation risk when workers contact the cutting fluid, and has a good application prospect. And the biodegradability is good, the biodegradability is easy to decompose by microorganisms in the natural environment, and the goal of'zero emission 'is favorably realized.
Owner:HUBEI CHENGXIANG TECH

Plant type bactericide for metal working fluid as well as preparation method and application of plant type bactericide

The invention discloses a botanical fungicide for metal working fluid, which is prepared from the following raw materials in parts by weight: malus hupehensis extract, wolf thorn extract and melia azedarach extract according to the mass ratio of 1: (2-4): (2-4). The bactericide is natural in raw materials, can effectively inhibit bacteria, fungi and anaerobic bacteria, has a broad-spectrum bactericidal effect, is good in stability, can effectively avoid the problem of spoilage of the metal working fluid, is good in compatibility with the metal working fluid, is not liable to generate a precipitation reaction with other additives in the working fluid, is not liable to generate drug resistance, and is safe and reliable. The skin irritation risk when workers make contact with the disinfectant can be remarkably reduced, the disinfectant has good biodegradability, is easily decomposed by microorganisms in the natural environment, does not leave lasting chemical residues like traditional bactericides, and is beneficial to achieving the zero emission target.
Owner:HUBEI CHENGXIANG TECH

Sofa (junk wood white blank)

1. Name of the designed product: sofa (white blank of Melia azedarach). 2. Use of the designed product: for people to rest. 3. Design points of the designed product: in shape. 4. Picture or photo best showing the design points: perspective view. 5. Part of the designed product not easily seen or not seen when in use is omitted, and the top view is omitted.
Owner:龙金萍

A granular medicine of erdun-7 and a preparation method thereof

ActiveCN122124183ANervous disorderAnthropod material medical ingredientsRubus sachalinensisElecampane
This invention relates to the field of Mongolian medicine preparation technology, and discloses an Erdun-7 granule preparation and its preparation method, which is made from the following raw materials in parts by weight: 1 part of *Inula japonica* and 1.3-1.8 parts of *Rubus idaeus*, used to regulate qi, relieve exterior symptoms and reduce fever; 1.6-2.4 parts of *Sophora flavescens*, 0.7-1.3 parts of *Gardenia jasminoides*, and 0.7-1.3 parts of *Terminalia chebula*, used to enhance the heat-clearing, fire-purging, detoxifying and blood-cooling effects of *Inula japonica* and *Rubus idaeus*; 0.8-1.2 parts of *Uncaria rhynchophylla* and 0.8-1.2 parts of *Cicada slough*, used to calm the liver, extinguish wind, and stop spasms; and 0.7-1.3 parts of *Kaempferia galanga* and 0.7-1.3 parts of *Melia azedarach*. This Erdun-7 granule preparation and its preparation method target the anticonvulsant effect of the granules, prolonging the latency period and reducing the incidence and severity, which is significantly better than traditional preparations, demonstrating the synergistic effect of clearing heat and relieving exterior symptoms and extinguishing wind and stopping spasms.
Owner:ORDOS MONGOLIAN MEDICINE HOSPITAL (ORDOS MONGOLIAN MEDICINE RES INST)

Cleaning, anti-dandruff and hair-care composition containing melia azedarach seed oil

The invention belongs to the field of daily chemicals, and particularly relates to a cleaning, anti-dandruff and hair-care composition containing melia azedarach seed oil, which comprises the following components by weight: 1-5% of melia azedarach seed oil; 0.5-2% of a radix sophorae flavescentis extract; 1-30% of a surfactant; 0.1 to 4% of a cationic conditioner; 1-5% of a humectant; and the balance deionized water. The melia azedarach seed oil is matched with the radix sophorae flavescentis extract, and the melia azedarach seed oil and the radix sophorae flavescentis extract have a synergistic effect, so that the anti-dandruff and anti-inflammatory repair effects are very good. The melia azedarach seed oil is matched with the radix sophorae flavescentis extract, so that on one hand, the micro-ecological environment of scalp water-oil balance can be adjusted, the scalp micro-ecology is improved, and the anti-dandruff, antibacterial and anti-inflammatory capacities of the composition are improved; on the other hand, the effects of resisting oxidation, moisturizing, caring, nourishing and moistening the hair can be achieved together, so that the undesirable phenomena that the hair is dry, frizzy, tangled, split, prone to breakage and the like are reduced, the damaged, dry and oxidized matt hair is repaired, the smoothness and toughness of the hair are enhanced, and the health state of scalp and the hair is improved.
Owner:OPAL COSMETICS HUIZHOU

Essence with acarus killing function and preparation method thereof

The invention relates to the technical field of essence, and particularly discloses essence with an acarus killing function and a preparation method of the essence. The essence with the acarus killing function comprises the following components: a main perfume, a fixative, a modifier, a blending perfume, an acarus killing agent and a solvent. Wherein the modifier at least comprises polianthes tuberose absolute oil, peppermint oil, star anise oil, Roman chamomile oil and Argentina lemon oil, and the miticide comprises a melia azedarach extract, a sophora flavescens extract, a verbena extract and a salvia officinalis extract. The essence with the acarus killing function not only can provide pleasant fragrance experience, but also can effectively remove acarus in the use process, has both safety and environmental protection property, and meets the pursuit of consumers for healthy and quality life.
Owner:GUANGZHOU CHENGXIN SPICE TECHNOLOGY CO LTD

Construction method of characteristic chromatogram of aqueous extract of melia azedarach l. bark and identification method thereof

The application relates to the technical field of traditional Chinese medicine detection and analytical chemistry, in particular to a characteristic spectrum construction method of water extracts of Melia toosendan fruits and a distinguishing method thereof, and specifically relates to a characteristic spectrum construction method of water extracts of Melia toosendan fruits with same or different origins, a distinguishing method between water extracts of Melia toosendan fruits with different origins, and a distinguishing method between water extracts of Melia toosendan fruits and water extracts of other similar medicinal materials. The characteristic spectrum of the technical scheme can objectively reflect the chemical characteristic information of the water extracts of Melia toosendan fruits, meets the basic requirements of integrity, characteristic and stability, and solves the problems of characteristic loss and difficulty in distinguishing after the medicinal materials are prepared into water extracts.
Owner:GUANGDONG YIFANG PHARMA

Functional compound protease biological mosquito and fly repelling antibiotic-free premix and preparation method thereof

The invention relates to the technical field of biological additives, and discloses a functional compound protease biological mosquito and fly repelling non-antibiotic premix and a preparation method thereof.The microcapsule sequentially comprises a fermentation function inner core, a high-temperature-resistant protective layer and a targeted controlled release outer layer from inside to outside, the inner core with the fermentation function is prepared by symbiotic fermentation of trichoderma harzianum and aspergillus niger on a culture medium containing melia azedarach meal and vegetable oil glyceride, compound protease, azadirachtin active matters and a biological surfactant are integrally generated, and the high-temperature-resistant protective layer is composed of thermally induced gel modified sodium alginate and is used for resisting high-temperature processing of the feed; the targeted controlled-release outer layer is formed by compounding a pH sensitive polymer and cellulose nanocrystals, and the structure ensures that the microcapsule is stable in the stomach of an animal and disintegrates in excrement excreted from the body due to dual effects of pH rise and microbial degradation. The problems that an existing biological agent is poor in thermal stability and single in action target spot are solved, and the biological agent has the double effects of killing fly maggots and repelling mosquitoes and is accurate and efficient.
Owner:WEIFANG XINGHE BIOTECHNOLOGY CO LTD

Ecological prevention and control method for betula alnoides man-made forest trunk borer pseudocotona moth

PendingCN121128519ACultivating equipmentsPlant protectionXylotrupesAnoplophora nobilis
The invention discloses an ecological prevention and control method for trunk borers of betula alnoides in an artificial forest of betula alnoides. According to the method, when a betula alnoides artificial forest is built, melia azedarach and betula alnoides are mixed and planted in a dotted uniform configuration mode. Volatile active substances released by leaves, flowers and fruits of melia azedarach cooperate with toosendanin diffused by carriers such as pollen and tiny tissue debris of melia azedarach to form a biological barrier which can effectively interfere with olfaction localization, growth and development and reproduction behaviors of the parapsilotona in forest air, so that ecological prevention and control of the parapsilotona in the betula alnoides artificial forest are realized. The whole planting density of the betula alnoides artificial forest is 111-167 plants per mu, 101-162 plants of the betula alnoides are planted per mu, 5-10 plants of the melia azedarach are planted per mu, and the maximum ecological prevention and control effect is achieved with the minimum number of the melia azedarach plants. The method can effectively control the damage of trunk borers of Betula alnoides in the artificial forest, reduces the use of pesticides, reduces the prevention and control cost, improves the wood quality, and promotes the sustainable operation of forest stands.
Owner:RES INST OF TROPICAL FORESTRY CHINESE ACAD OF FORESTRY +1

Metal processing synthetic fluid taking plant extract as bactericide and preparation method thereof

The invention discloses a metal processing synthetic fluid using a plant extract as a bactericide. The metal processing synthetic fluid comprises the following raw materials: deionized water, ethanolamine, binary acid, boric acid, sodium hydroxide, dimer acid, dodecenylsuccinic acid, tall oil, sodium thiosulfate, sodium methyl cellulose and the plant extract bactericide. The plant extract bactericide is a mixture of malus hupehensis extract, wolf thorn extract and melia azedarach extract; the metal working fluid has the advantages that the efficient control on microorganisms in the metal working fluid is realized, bacteria, fungi and anaerobic bacteria can be effectively inhibited, the broad-spectrum bactericidal effect is realized, the compatibility is very good, the stability is good, the reaction with a lubricant or an anti-rust agent is avoided, the precipitation or floating oil is not generated, and the uniformity and the lubricating property of the metal working synthetic fluid are not damaged; according to the present invention, the skin irritation risk during the contact with the worker can be significantly reduced, and the product has good biodegradability, can be easily decomposed by microorganisms in the natural environment, and can easily achieve the zero emission target.
Owner:HUBEI CHENGXIANG TECH

Device and method for treating ichthyophthiriasis of largemouth bass

The invention discloses a treatment device and a treatment method for ichthyophthiriasis of largemouth bass, and belongs to the technical field of aquaculture. The device comprises a treatment bin, a filtering bin and a medicine bin, a disinfecting and killing device is further arranged between the filtering bin and the medicine bin, and all the components cooperate to achieve water circulation, temperature control, salinity adjustment, medicine mixing and disinfecting and filtering. During treatment, the temperature of a water body is stable, the salinity is accurately adjusted through the salt adding box, the salinity is adjusted from high salinity to low salinity, then melia azedarach oil and eucalyptus oil with specific dosage are matched to kill ichthyophthirius multifiliis, and then povidone iodine is used for disinfection and vitamin C is used for assisting recovery. The method solves the problems of large drug dosage, high energy consumption, inaccurate salinity adjustment and easy disease recurrence in the prior art, has the advantages of drug and energy consumption saving, accurate salinity adjustment, thorough treatment and simple and convenient operation, and is suitable for efficient treatment of industrial largemouth bass ichthyophthiriasis.
Owner:NANJING INSTITUTE OF FISHERY SCIENCES (NANJING AQUATIC TECHNOLOGY PROMOTION STATION NANJING AQUATIC ANIMAL DISEASE PREVENTION & CONTROL CENTER)

Primers required by SNP molecular marker for identifying melia azedarach lingering variety, method and application thereof

The invention belongs to the field of molecular biology, and particularly relates to primers and a method for identifying SNP molecular markers of a melia azedarach lingering variety and application of the primers and the method for identifying the SNP molecular markers of the melia azedarach lingering variety. According to the present invention, the primers comprise an SNP (single nucleotide polymorphism)-F: GATTTGAACCTATACCAAAGG, and an SNP-R: GCATCGCTGAATTGAATACG, the identification method comprises the following steps: collecting a molecular specimen; extracting DNA (deoxyribonucleic acid); after the primers SNP-F and SNP-R are used for carrying out SNP fragment amplification, electrophoresis, screening and sequencing, the obtained SNP fragments are sequenced, and if single base mutation exists at the 33rd site in the 5 '-3' direction in the SNP sequence, the variety of which C is mutated into A is honeydew lingering. The invention also discloses an application of the primer required by the SNP molecular marker in a reagent and a kit. According to the method, accurate identification can be directly realized on the basis of mononucleotide variation, and the defects of traditional morphological identification are effectively overcome, so that a new variety of Honeylocust can fully exert the value of the new variety in the fields of ecological restoration, economic material development, medicinal resource development and the like, and large-scale high-quality development of the melia azedarach industry is assisted.
Owner:SHIJIAZHUANG SHENZHOU FLOWER RES INST CO LTD +2

A method for separating and determining the chemical components in melia azedarach

The application belongs to the technical field of quality detection of traditional Chinese medicine, and specifically provides a separation method and a content determination method of chemical components in Murraya paniculata, and establishes a content determination method for simultaneously determining contents of four components of murrayaketone, 5,7,3',4',5'-pentamethoxyflavone, 5-hydroxy-3',4',6,7-tetramethoxyflavone and nor-chenpienoside in Murraya paniculata, so that the four components in Murraya paniculata can be accurately, quickly and conveniently determined, the analysis efficiency is obviously improved, the quality of related products of Murraya paniculata can be better guaranteed, and the quality of Murraya paniculata can be quickly, accurately and comprehensively detected.
Owner:CHINA RESOURCES SANJIU MEDICAL & PHARMA CO LTD +3

A polysaccharide of gold bell and an extraction method and application thereof

ActiveCN118184811BCholesterol bindingEnzyme inhibition
This invention provides a polysaccharide from *Melia azedarach*, its extraction method, and its applications, belonging to the field of polysaccharide extraction technology. The *Melia azedarach* polysaccharide includes at least one of *Melia azedarach* polysaccharide 1 and *Melia azedarach* polysaccharide 2. *Melia azedarach* polysaccharide 1 comprises the polysaccharide molecule represented by formula (I), and *Melia azedarach* polysaccharide 2 comprises the polysaccharide molecule represented by formula (II). This invention also provides a method for extracting this *Melia azedarach* polysaccharide. This *Melia azedarach* polysaccharide exhibits good effects in fat binding, bile acid binding, cholesterol binding, and lipase inhibition, and has broad application prospects in the preparation of lipid-lowering products.
Owner:BEIJING TECH & BUSINESS UNIV

A melia azedarach flower-based essence, a preparation method and application thereof

PendingCN122628832AChemical productsAroma aroma
The application discloses a melia azedarach flower fragrance, a preparation method and application, is scientifically compounded by multiple types of spices, and relies on component synergistic effect to accurately restore the characteristic fragrance of natural melia azedarach flowers. The fragrance is resistant to temperature and humidity, is not prone to rancidity and odor, is compatible with various bases such as water agent, grease and colloid, has no stratification and precipitation, and can be widely applied to daily chemical products. The application solves the problems that melia azedarach flowers are not suitable for indoor and public planting and cannot provide fragrance at any time.
Owner:XIAMEN XIN MILAN FLAVORS & FRAGRANCES CO LTD

Melaleuca alternifolia seedling incubator

The utility model discloses a melaleuca alternifolia seedling culture box which comprises a box body, frames used for placing seedling culture plates are arranged in an inner cavity of the box body at different heights, a plurality of culture grooves used for cultivating seedling bodies are distributed on the tops of the seedling culture plates in a rectangular mode, connecting mechanisms are arranged on the side faces of the seedling culture plates, and a water tank is arranged in the box body. A first water pump is arranged on the water tank, the first water pump is connected with a branch pipe through a main pipeline, and the bottom of the branch pipe is connected with a spray head. According to the utility model, the sensor group is arranged in the box body, so that the environment temperature and humidity and the carbon dioxide concentration in the box body can be detected, and instructions are sent to corresponding mechanisms through the controller when various corresponding indexes change obviously, so that the aim of automatically adjusting the environment temperature and humidity is fulfilled.
Owner:GUANGXI FORESTRY RES INST

A traditional Chinese medicine composition and preparation for external use on pet skin, and a preparation method and application thereof

PendingCN122097523Asimple recipeCompatibility is reasonableAntimycoticsDermatological disorderCnidiumHaloxylon
The present application belongs to the technical field of pet medicine, and particularly relates to a traditional Chinese medicine composition and traditional Chinese medicine preparation for external use on pet skin, and a preparation method and application thereof. The traditional Chinese medicine raw materials contained in the traditional Chinese medicine composition of the present application include: Sophora flavescens, Stachys, Cnidium, Dictamnus dasycarpus, Taraxacum mongolicum, Phellodendron, Portulaca oleracea, Semen Haloxylon, and Melia azedarach. On the basis of years of clinical work experience and professional knowledge, the present application successfully obtains a traditional Chinese medicine composition and traditional Chinese medicine preparation for treating pet skin diseases. The traditional Chinese medicine composition of the present application is simple in prescription, reasonable in compatibility, safe and environmentally friendly, natural and hormone-free, and safe and reliable in use.
Owner:JIAXIANG HUAMENG BIOLOGICAL FEED CO LTD

Traditional Chinese medicine patch for external care of postpartum acute mastitis and its preparation method

This invention provides a topical herbal patch for postpartum acute mastitis and its preparation method, belonging to the field of traditional Chinese medicine pharmaceutical technology. The patch is composed of *Paris polyphylla*, *Vaccaria segetalis*, *Uncaria rhynchophylla*, *Bombyx mori*, *Mild Glauber's salt*, processed *Evodia rutaecarpa*, *Citrus aurantium*, *Cirsium japonicum*, *Smilax china*, *Siegesbeckia orientalis*, stir-fried *Melia azedarach*, and licorice. Based on a rigorous formula of principal, assistant, and adjuvant herbs, this patch significantly reduces serum TNF-α, IL-1β, and IL-6 levels in mice with postpartum mastitis, and significantly improves the overall clinical efficacy. It rapidly relieves core symptoms such as breast redness, swelling, pain, and induration, clears milk stasis, and possesses multiple effects including anti-inflammatory, anti-swelling, lactation-promoting, and analgesic properties. This herbal patch is a topical care preparation that acts directly on the affected area of ​​the breast. The drug is absorbed transdermally without gastrointestinal metabolism, and its components do not affect the infant through breast milk. This provides a safe, efficient, and convenient new topical care solution for postpartum acute mastitis.
Owner:THE FIRST AFFILIATED HOSPITAL OF ZHENGZHOU UNIV

Forest management method for improving quality and efficiency of chinese fir plantation, application and chinese fir plantation

The application discloses a forest management method for improving quality and efficiency of Chinese fir plantations, application and Chinese fir plantations, and the management method for improving quality and efficiency of Chinese fir plantations comprises the following steps: cutting part of trees in the Chinese fir forest, so that the remaining density of the existing stand is 100-1050 trees per hectare; planting valuable and native tree species in the gaps of the stand, and the number of the planted trees is 300-1260 trees per hectare; and the planted tree species are at least three of the following: Phoebe zhennan, Liquidambar formosana, Schima superba, Cinnamomum camphora, Cyclobalanopsis glauca, Taxus wallichiana, Ginkgo biloba, Machilus zuihoensis, Melia azedarach and Sapium rotundifolium. 2 2 2 2 The valuable and native tree species are selected according to the local conditions, and the different-age, multi-layer and mixed stands are cultivated, the valuable timber is reserved, and the management purpose of improving quality and efficiency of the Chinese fir plantations is achieved.​​​
Owner:HUNAN PROSPECTING DESIGNING & RES INST FOR AGRI FORESTRY & IND +1

Cream paper added with turpinia arguta leaf extracting solution and preparation method of cream paper

The invention discloses cream paper added with a turpinia arguta leaf extracting solution and a preparation method of the cream paper, and relates to the technical field of cream paper. The cream paper added with the turpinia arguta leaf extracting solution consists of base paper and a cream layer coated on at least one surface of the base paper, the cream layer is prepared from the following raw materials in parts by mass: 1-20 parts of a turpinia arguta leaf extracting solution, 5-30 parts of a humectant, 3-25 parts of an oily component, 1-10 parts of an emulsifier, 0.1-5 parts of a thickening stabilizer, 0.5-1.5 parts of an antioxidant and bacteriostatic active component, 0.1-5 parts of a skin soothing agent and the balance of deionized water which is added to 100 parts. According to the cream paper, the limitation that existing cream paper is mainly based on basic moisturizing is broken through, the turpinia arguta leaf extracting solution is matched with the specific antioxidant and bacteriostatic active ingredients, the multiple functions of resisting bacteria, resisting oxidation and moisturizing are combined, the irritation of a synthetic antibacterial / antioxidant is avoided, and the natural and mild consumer demand is better met.
Owner:SHANXIANGYUAN (HANGZHOU) BIOTECHNOLOGY CO LTD

Turpinia arguta ointment and preparation method thereof

The invention relates to the technical field of external ointment, in particular to turpinia arguta ointment and a preparation method thereof. The traditional Chinese medicine composition is mainly prepared from the following raw materials in parts by weight: 1-3 parts of turpinia arguta leaf extract; 8-12 parts of tea oil; 1-4 parts of camphor tree essential oil; 1-5 parts of natural beeswax; the total asiaticoside is strategically introduced into a traditional anti-inflammatory analgesic system composed of the turpinia arguta leaf extract, the tea oil, the camphor tree essential oil and the natural beewax, and the stability of active ingredients in the turpinia arguta ointment is improved through the preparation method, so that the turpinia arguta ointment has the instant effects of rapidly resisting bacteria and diminishing inflammation and relieving swelling and pain; the invention relates to a multifunctional external preparation which can be used for promoting fibroblast proliferation and collagen ordered synthesis, actively accelerating wound healing and remarkably inhibiting scar formation, so that on the premise of ensuring excellent storage stability and use safety, the function span from pure symptom control to active tissue repair is realized.
Owner:JIANGXI ACAD OF FORESTRY

A biological preparation for preventing and treating diseases and insect pests of traditional Chinese medicinal materials, a preparation method and application thereof

PendingCN122623685ABiotechnologyVitamin C
The present application provides a kind of biological preparation for preventing and treating Chinese herbal medicine diseases and pests and its preparation method and application, belong to the technical field of Chinese herbal medicine green planting diseases and pests prevention and control.The biological preparation of the present application includes composite bacteria powder, plant source extract, slow-release carrier and functional additive;The composite bacteria powder is composed of bacillus subtilis, paecilomyces lilacinus and saccharomyces eubayanus, the plant source extract is the composite alcohol extract of melia azedarach, cnidium fruit and phellodendron, the slow-release carrier is composed of diatomite and humic acid, and the functional additive is composed of polyglycerol fatty acid ester, sodium alginate and vitamin C.The biological preparation of the present application can simultaneously and efficiently prevent and control the aerial piercing-sucking pests of Chinese herbal medicine, the aerial chewing pests, soil-borne fungal diseases, bacterial diseases and / or root-knot nematode diseases, and the preparation process is simple, can be mass-produced, and has good market prospect.
Owner:CHENFENG NATURAL MATERIA MEDICA (BEIJING) TECH CO LTD

Colloidal silver and plant ear mite removing composite composition as well as preparation method and application thereof

The invention relates to the technical field of veterinary drugs, and particularly discloses a colloidal silver and plant ear mite removing composite composition as well as a preparation method and application thereof. The composition is prepared from 0.1 wt%-0.5 wt% of colloidal silver, 0.1 wt%-0.5 wt% of 4-terpineol, 0.2 wt%-1 wt% of blumea oil, 10 wt%-30 wt% of a surfactant, 1.5 wt%-6 wt% of composite extracts (extracts of melia azedarach, geranium and hamamelis virginiana), 0.01 wt%-0.1 wt% of a complexing agent, 2 wt%-8 wt% of an organic solvent, deionized water and the like. Through synergism of all the components, the effects of resisting bacteria, killing mites, resisting inflammation and cleaning are achieved, and the problems of pet ear mite infection and ears are comprehensively solved. The invention also provides a preparation method of the composition, through step-by-step treatment, the activity of the components is ensured, and the stability and safety of the product are improved. The composition can be prepared into an ear mite removing product for pets, so that the ear health of the pets is effectively nursed.
Owner:GUANGZHOU WEINUO ANIMAL PHARM CO LTD

Bio-organic fertilizer for preventing and treating rhizobium and preparation method of bio-organic fertilizer

The invention provides a bio-organic fertilizer for preventing and treating rhizobium and a preparation method thereof, and belongs to the technical field of fertilizers. The bio-organic fertilizer for preventing and treating the nodule disease is prepared from the following components in parts by weight: 30 to 50 parts of radix astragali seu hedysari, 30 to 50 parts of radix codonopsis, 20 to 40 parts of herba artemisiae annuae, 10 to 30 parts of fructus meliae azedarach, 15 to 35 parts of radix tripterygii wilfordii, 0.5 to 1.5 parts of complex microbial inoculants, 20 to 40 parts of agaricus bisporus residues, 15 to 25 parts of humic acid, 10 to 20 parts of animal waste, 8 to 12 parts of soybean meal and 5 to 15 parts of vegetable sponge. The bio-organic fertilizer can realize the synergistic interaction of nutrition supply, micro-ecological regulation and control and pathogenic bacteria inhibition, not only can exert the efficacy of traditional Chinese medicines, but also can provide balanced nutrition for crops, and can continuously inhibit pathogenic organisms such as agrobacterium tumefaciens and root-knot nematode through colonization of functional microorganisms and accumulation of metabolites, so that the yield of the crops is increased. The effect of effectively preventing and treating the rhizobium is achieved.
Owner:GANSU BENCAOYUAN TRADITIONAL CHINESE MEDICINE CO LTD