D-psicose-3-epimerase active aggregate as well as preparation method and application thereof

A technology of epimerase and allulose, which is applied in the field of enzyme engineering, can solve the problems of low recycling rate, poor thermal stability, unfavorable cost control of D-psicose, etc., to reduce production costs and improve Yield and yield, effects of loss avoidance

Active Publication Date: 2021-12-17
SOUTH CHINA UNIV OF TECH +1
View PDF5 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Wherein, the recombinant escherichia coli containing the dpe gene of Clostridium cellulolyticum and Agrobacterium tumefaciens has higher conversion rate of D-fructose and D-psicose, about 33%, but the latter is under the optimal reaction condition ( 50℃) half-life is only 63.5min
[0005] In addition, the current D-psicose-3-epimerase generally has problems such as poor thermal stability and low reuse rate under optimal reaction conditions, which is not conducive to the large-scale industrial production of D-psicose. Cost Control

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • D-psicose-3-epimerase active aggregate as well as preparation method and application thereof
  • D-psicose-3-epimerase active aggregate as well as preparation method and application thereof
  • D-psicose-3-epimerase active aggregate as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1 Obtaining of D-psicose-3-epimerase active aggregates (obtaining a fragment containing D-psicose-3-epimerase-connecting peptide-self-aggregating short peptide )

[0074] 1. Obtain the Rum55-PT-ELK16 target fragment containing pET30a vector and restriction site sequence

[0075] According to the connecting peptide PT-linker (SEQ ID NO.18), self-aggregating short peptide ELK16 (SEQ ID NO.19), D-psicose-3-epimerase Rum55 (SEQ ID NO.17), and the gene sequence of the pET30a vector (purchased from Solarbio, Cat. No. P3120), respectively designed primers to amplify the PT-ELK16 fragment and the Rum55-PT fragment, and used the above two amplified fragments as templates to design The primers of the dot sequence were used for overlap PCR amplification, and finally the target fragment of Rum55-PT-ELK16 containing the pET30a vector and restriction site sequence was obtained. The details are as follows:

[0076] (1) PT-ELK16 fragment PCR amplification

[0077] Amplified...

Embodiment 2

[0106] Example 2 Effects of different self-aggregating short peptides on the activity of D-psicose-3-epimerase active aggregates

[0107] According to the method of Example 1, the self-aggregating short peptide (ELK16, SEQ ID NO.2, 18A, SEQ ID NO.4, R18A, SEQ ID NO.5 and L6KD, SEQ ID NO.3)-PT-linker was constructed To the C-terminus of Rum55, D-psicose-3-epimerase active aggregates expressing different self-aggregating short peptide compositions were obtained: Rum55-L6KD aggregates (Rum55-PT-L6KD, SEQ ID NO.14 ), Rum55-PT-18A aggregate (Rum55-PT-18A, SEQ ID NO.15) and Rum55-R18A aggregate (Rum55-PT-R18A, SEQ ID NO.16) engineering bacteria: E.coli Rosetta (DE3) / pET30a-Rum55-L6KD, E.coli Rosetta(DE3) / pET30a-Rum55-18A, E.coli Rosetta(DE3) / pET30a-Rum55-R18A, as follows:

[0108] The gene sequences of L6KD, 18A and R18A are shown in SEQ ID NO.40, 41 and 42, respectively. Respectively with primers PT-L6KD-F (SEQ ID NO.44) and PT-L6KD-R (SEQ ID NO.45), PT-18A-F (SEQ ID NO.47) and ...

Embodiment 3

[0121] Example 3 Expression of Rum55-ELK16 in Bacillus subtilis

[0122] 1. Construction of plasmid pMA5-Rum55 ELK16

[0123] The pMA5 empty vector plasmid was double-digested with restriction endonucleases BamHI and MluI, and the digested vector fragment was gel-cut and recovered; using the Rum55-PT-ELK16 fragment obtained in Example 1 as a template, a Primer pMA5-BamHI-Rum55-F of pMA5 vector and restriction site sequence: agaatgcaaaaagtgaaatcaggg ggatcc ATGAACAAGATCGGAGTTCATTTTGGA (SEQ ID NO.29, the underlined base is the restriction endonuclease BamHI recognition site,) and pMA5-MluI-ELK-R: tcgaggtgaatttcgacctctaga acgcgt TTATTTCAGCTTTAATTCTAATTCCAGTTTTAA (SEQ ID NO.30, the underlined base is the restriction endonuclease MluI recognition site) was amplified to obtain the Rum55-PT-ELK16 target fragment (SEQ ID NO. 31), using the pEASY-UniSeamless Cloning and Assembly Kit (Beijing Quanshijin Biotechnology Co., Ltd.), the recovered vector fragment was combined with the amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention belongs to the technical field of enzyme engineering, and discloses a D-psicose-3-epimerase active aggregate as well as a preparation method and application thereof. The D-psicose-3-epimerase active aggregate comprises D-psicose-3-epimerase and a self-aggregation oligopeptide, so that the reaction temperature of the D-psicose-3-epimerase can be increased, and the half-life period of the D-psicose-3-epimerase can be prolonged; the dependence on metal ions is obviously reduced; and the reutilization frequency is increased.

Description

technical field [0001] The invention belongs to the technical field of enzyme engineering, and in particular relates to a D-psicose-3-epimerase active aggregate and a preparation method and application thereof. Background technique [0002] With the acceleration of urbanization, increasing environmental pollution, changes in people's lifestyles, and population aging, the incidence of chronic metabolic diseases such as obesity and diabetes has risen sharply around the world. Excessive consumption of carbohydrates is an important cause of obesity and diabetes. How to maintain the level of sweetness that people are accustomed to, while reducing the absorption of sugar in the intestines and reducing energy intake is one of the current research hotspots in the field of nutrition and medicine, and it is also an important issue that the food industry needs to solve urgently. [0003] D-psicose (D-psicose) is the epimer of D-fructose (D-fructose) C-3, its sweetness is equivalent to...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70C12N1/21C12P19/02C12P19/24C12R1/19
CPCC12N9/90C12N15/70C12Y501/03C12P19/02C12P19/24C07K2319/00
Inventor王靖林章凛陈博杨晓锋王小艳张媛郭元亨安泰周娜娜
OwnerSOUTH CHINA UNIV OF TECH