Unlock instant, AI-driven research and patent intelligence for your innovation.

Probe set for detecting ALK (Anaplastic Lymphoma Kinase) gene rearrangement and application thereof

A technology of gene rearrangement and probe group, which is applied in recombinant DNA technology, microbial measurement/testing, DNA/RNA fragments, etc., can solve the problems of large probe fragments, long hybridization time, and low probe specificity. Achieve high specificity and improve resolution

Pending Publication Date: 2022-01-11
WUHAN YZY MEDICAL SCI & TECH
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Traditional commercialized ALK gene FISH detection mainly uses BAC (Bacterial Artificial Chromosome) clones as probes for hybridization detection after fluorescent molecular labeling. However, the probes prepared by BAC clones have some non-repetitive sequences, and the specificity of the probes is not high. Use Cot1-DNA for non-specific blocking, and the probe fragments are generally too large, the length is between 200-500bp, the hybridization efficiency is low, and the hybridization time is long

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Probe set for detecting ALK (Anaplastic Lymphoma Kinase) gene rearrangement and application thereof
  • Probe set for detecting ALK (Anaplastic Lymphoma Kinase) gene rearrangement and application thereof
  • Probe set for detecting ALK (Anaplastic Lymphoma Kinase) gene rearrangement and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] This embodiment provides a method for preparing a probe set for detecting ALK gene rearrangement, which specifically includes the following steps:

[0027] S1, based on the sequence of the ALK gene, design nucleotide sequences containing 45 bases in the 100kb region without repetitive sequences, set the Tm value of the probe at 50°C, and the GC content range of 40-60%. After discarding the sequence containing AAAA / TTTT / CCCC / GGGG, and then after the whole gene (hg38) BLAST analysis, a total of 3221 nucleotide sequences were finally obtained, as shown in Table 1 below;

[0028] S2, add a 20bp tag sequence to the 5' end of each nucleotide sequence and a 20bp tag sequence to the 3' end to obtain a series of characteristic primers with tag sequences, wherein the 5' end tag sequence is : TAATACGACTCACTATAGGG (SEQ ID NO: 1), the 3' end tag sequence is: CCGCTGAGCAATAACTAGCA (SEQ ID NO: 2);

[0029] S3, using high-throughput chip synthesis technology, according to the character...

Embodiment 2

[0063] Embodiment 2 Normal people's peripheral lymphocyte drip experiment

[0064] Materials: human peripheral blood lymphocyte culture medium, colchicine, hypotonic solution (0.4% KCl), fixative solution (methanol:acetic acid=3:1, volume ratio)

[0065] S1, cell culture and synchronization: take 0.4mL heparin anticoagulated whole blood (from the hospital) in human peripheral blood lymphocyte culture medium, mix well and store at 37°C, 5% CO 2 Cultivate in a constant temperature incubator for 72 hours, and 4 hours before termination, add colchicine to the medium to a final concentration (0.1 μg / mL) and continue to cultivate for 4 hours;

[0066] S2, collection and fixation: collect the medium, centrifuge at 500g for 5min, discard the supernatant, add 0.4% KCl hypotonic solution and incubate for 30min, then fix the cells with methanol-glacial acetic acid mixture, let stand at room temperature for 10min, centrifuge at 500g to pellet the cells , repeat the cell fixation step onc...

Embodiment 3

[0073] Referring to the method in Example 2, the slide containing 50 metaphase lymphocytes was detected, and the results are shown in Table 3 below. It can be seen that there are 99 FISH signal points of the ALK gene probe, and the sensitivity reaches 99%.

[0074] Table 3 Sensitivity test results of probes

[0075] probe type Metaphase lymphocytes (units) FISH signal points (pieces) sensitivity ALK gene probe 50 99 99%

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a probe set for detecting ALK (Anaplastic Lymphoma Kinase) gene rearrangement and application thereof. The probe set is prepared from 3221 nucleotide sequences shown in the specification table 1. According to the invention, in a target region of an ALK gene, a single-chain fragment, which is completely complementary with the target region and has a length of 45bp, is directly constructed as a candidate probe; then each sequence is subjected to batch BLAST comparison, so that high specificity of each hybridized probe sequence is ensured; meanwhile, the targeting of the target region is accurately controlled; the size limitation of the probe is broken through; the resolution of the probe is improved; and in the preparation process, a PCR (Polymerase Chain Reaction) doping method is adopted to ensure that the product contains more fluorophores. The probe set is used for detecting the ALK gene rearrangement state; the cost is relatively low; FISH hybridization of a paraffin tissue sample can be completed within 30 minutes; the sensitivity is high; the specificity is strong; the hybridization background is clean; and the signal-to-noise ratio is low.

Description

technical field [0001] The invention relates to the technical field of gene detection, in particular to a probe set for detecting ALK gene rearrangement and its application. Background technique [0002] The anaplastic lymphoma kinase (ALK) gene is located on the short arm of chromosome 2, belongs to the insulin receptor superfamily, and encodes the ALK protein. [0003] Non-small cell lung cancer (NSCLC) accounts for approximately 80-85% of lung cancers and is the leading cause of cancer-related death in both men and women worldwide. ALK gene rearrangements are driver mutations in the development of NSCLC and have been shown to be found in 5-6% of NSCLC cases. Moreover, with the deepening of research, more than 19 different ALK fusion partners have been found in NSCLC, including EML4, KIF5B, KLC1 and TPR. Therefore, the detection of ALK gene rearrangement status has important clinical significance. [0004] Fluorescence in situ hybridization assay is considered the gold s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6841C12Q1/6827C12Q1/6811C12N15/11
CPCC12Q1/6841C12Q1/6827C12Q1/6811C12Q2563/107C12Q2565/519C12Q2531/113C12Q2537/165
Inventor 祝丹平魏亮朱燕华
Owner WUHAN YZY MEDICAL SCI & TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More