Method for detecting JC polyoma virus through real-time fluorescent quantitative PCR (Polymerase Chain Reaction)

A real-time fluorescence quantitative, polyoma virus technology, applied in the field of biomedicine, can solve the problem of low coverage of JC virus variant strains, and achieve the effects of reducing labor and material costs, high sensitivity, and ensuring safety.

Pending Publication Date: 2022-01-11
SUZHOU YAOMING KANGDE INSPECTION TESTING
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the existing methods for detecting JC virus have a low coverage rate of JC virus mutant strains, and when the PCR method is used for detection, the detection sample DNA also contains a large amount of cellular DNA and a small amount of viral DNA, and the PCR reaction is often subject to a large number of tests. Inhibition of cellular DNA, therefore, requires the development of a highly sensitive assay that covers as many JC virus variants as possible without being affected by the large amount of background cellular DNA

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting JC polyoma virus through real-time fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Method for detecting JC polyoma virus through real-time fluorescent quantitative PCR (Polymerase Chain Reaction)
  • Method for detecting JC polyoma virus through real-time fluorescent quantitative PCR (Polymerase Chain Reaction)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] 1. Extraction of the cells to extract the total DNA to be tested, and adjusted the concentration of the DNA template to 0.1 μg / μL.

[0033] 2. For all JC virus separation plant genomic DNA sequences in the NCBI database, a positive primer, reverse primer, and probe of real-time fluorescence quantitative PCR are designed.

[0034] The nucleotide sequence of forward primers is: acagagcacaaggcgtac (shown in SEQ ID NO: 1);

[0035] The nucleotide sequence of reverse primers is: Tcctcctgttagtgtcccaaa (as shown in SEQ ID NO: 2);

[0036] The nucleotide sequence of the probe is: atcctgttgaatgtggggttcctgatcc (shown in SEQ ID NO: 3).

[0037] 3. Calculate the reactive number N of the real-time fluorescent quantitative PCR, and prepare the reaction system, the reaction system includes a premix, a forward primer, a reverse primer, a probe, and a template, and the premix is ​​TAQMAN UNIVERSAL MASTER MIX, and the template is a template target sequence. The preparation of the plasmid a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting JC polyoma virus through real-time fluorescent quantitative PCR (Polymerase Chain Reaction), provides a group of forward primers, reverse primers and probes for detecting JC virus in a biological product through real-time fluorescent quantitative PCR, and provides a PCR program for carrying out fluorescent quantitative PCR detection by utilizing the forward and reverse primers and the probes. The detection method provided by the invention can be used for detecting all JC viruses of different genotypes, is good in specificity, high in sensitivity and high in variant coverage, and compared with common virus cell culture detection, the detection time is greatly shortened, the labor and material cost is saved, and the detection method is suitable for complex detection of large-batch production of biological products.

Description

Technical field [0001] The present invention relates to the field of biopharmaceutical technology, and more particularly to a method of real-time fluorescence quantitative PCR to detect JC polymented viruses. Background technique [0002] JC virus (JCV) is a human polymented virus, which is a small double DNA virus that can be divided into more than 30 genotypes. JC virus infections are worldwide, statistics in different regions around the world, and adult JCV infection rates are 50% a 90%. JC viruses may have no obvious clinical manifestations through respiratory tract infections. After the primary infection, the viral blood will be caused by the virus, the virus reaches the kidneys, when the body is immunity, such as kidney transplantation or bone marrow transplantation, pregnant women, elderly, cancer, and AIDS patients are immune function, The virus can be reactivated and replicated. At this time, the virus is likely to selectively damage the central nervous system oligogenes...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/6851
CPCC12Q1/701C12Q1/6851C12Q2600/166C12Q2531/113C12Q2545/114C12Q2563/107
Inventor贾雪卿沈施佳董元舒童涌
OwnerSUZHOU YAOMING KANGDE INSPECTION TESTING