Application of mal33 gene deletion in improving tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors

A technology of lignocellulose and Saccharomyces cerevisiae, which is applied in microorganism-based methods, applications, genetic engineering, etc., can solve problems such as low tolerance, and achieve the effects of improving tolerance and shortening lag period.

Active Publication Date: 2022-05-06
QILU UNIV OF TECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In the process of producing second-generation fuel ethanol by using lignocellulosic raw materials, there is a problem that Saccharomyces cerevisiae has low tolerance to inhibitors in lignocellulose hydrolyzate, and the present invention provides MAL3 Application of 3 gene deletion in improving the tolerance of Saccharomyces cerevisiae to lignocellulosic hydrolyzate inhibitors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of mal33 gene deletion in improving tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors
  • Application of mal33 gene deletion in improving tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors
  • Application of mal33 gene deletion in improving tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1: MAL33 Construction of gene-deleted yeast strains

[0039] 1. Extraction of Saccharomyces cerevisiae genome

[0040] Saccharomyces cerevisiae BY4741 strain was cultured overnight in 5mL YPD medium, the cells were collected, and the BY4741 genomic DNA was extracted.

[0041] 2. Amplification of Gene Knockout Fragments

[0042] (1) MAL33 Amplification of the upstream homology arm and the downstream homology arm: using the genomic DNA of Saccharomyces cerevisiae BY4741 as a template, using primers UPS- MAL33 -F (5'-AATGGTCACTCCAAGTAACGGTATTGTGATTTCAACAGAA-3') and UPS- MAL33 -R (5'- TATTAAGGGTTGTCGACCTG ATCTTGACAACTGAGCTCTTTCACAC-3’) (underlined with loxP- KanMX4-loxP Homologous sequences upstream of the fragment for use with loxP-KanMX4-loxP for fusion PCR), and DOS- MAL33 -F (5'- TGATATCAGATCCACTAGTG TAGGACCCCTCATCACAATGATT -3’) (the underlined part is the loxP-KanMX4-loxP Downstream homologous sequences for use with loxP-KanMX4-loxP fusi...

Embodiment 2

[0048] Example 2: MAL33 Gene deletion strains are resistant to acetic acid, other typical inhibitors and H 2 o 2 tolerance test

[0049] 1. MAL33 Evaluation of the fermentation of gene-deleted strains in YPD medium containing 3 g / L acetic acid in oxygen-limited shake flasks

[0050] to pick MAL33 Gene deletion strain BSPX051-3XI- mal33△ and control strain BSPX051-3XI were inoculated into 5 mL of YPD liquid medium, activated and cultivated in a shaker at 30°C at 200 rpm for 12 h to 24 h, and then transferred to 5 mL of fresh medium after the bacterial liquid was cloudy Carry out the second activation, the activation time is 12 h~24 h. Inoculate the activated seed solution into an oxygen-limited bottle filled with 30 mL YPD + 3 g / L acetic acid medium, and adjust the initial OD 600 0.2, at 30 ℃, 200 rpm shaker in the oxygen-limited shake flask fermentation, sampling every few hours, using a UV-visible spectrophotometer to measure the OD of the fermentation broth 600 ,...

Embodiment 3

[0054] Example 3: MAL33 Oxygen-limited shake flask evaluation of gene-deleted strains in mixed sugar medium containing 3.5 g / L acetic acid and mixed sugar medium containing mixed inhibitors

[0055] 1. MAL33 Evaluation of the oxygen-limited shake flask fermentation of gene-deleted strains in YPDX medium containing 3.5 g / L acetic acid

[0056] to pick MAL33 Gene deletion strain BSPX051-3XI- mal33△ and control strain BSPX051-3XI were inoculated into 5 mL of YPD liquid medium, activated and cultivated in a shaker at 30 °C at 200 rpm for 12 h to 24 h, and then transferred to 5 mL of fresh medium after the bacterial liquid was cloudy Carry out the second activation, the activation time is 12h~24h. Inoculate the activated seed solution into 30 mL of YPDX medium containing 3.5 g / L acetic acid, adjust the initial OD 600 0.2, at 30 ℃, 200 rpm shaker in the oxygen-limited shake flask fermentation, sampling every few hours, using a UV-visible spectrophotometer to measure the OD ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to MAL3 3 The application of gene deletion in improving the tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors belongs to the field of bioengineering. The present invention provides a strain MAL33 Saccharomyces cerevisiae strains with gene deletion have greatly improved tolerance to acetic acid; other typical inhibitors and H in lignocellulose hydrolyzate 2 o 2 The tolerance of the nutrient was also improved; the lag period in the 3.5 g / L acetic acid glucose-xylose medium (YPDX) was shortened by 24 h, and the fermentation cycle of ethanol production by co-utilization of glucose and xylose was shortened by 20 h; The growth and ethanol production of glucose and xylose co-fermentation in the glucose-xylose medium (YPDX) of inhibitors were better than those of the control strain; it provides a method for improving the tolerance of Saccharomyces cerevisiae to inhibitors in lignocellulose hydrolyzate , providing a theoretical basis for overcoming the technical bottleneck in the production of second-generation fuel ethanol.

Description

technical field [0001] The present invention relates to MAL3 3 The application of gene deletion in improving the tolerance of Saccharomyces cerevisiae to lignocellulose hydrolyzate inhibitors belongs to the field of bioengineering. Background technique [0002] In recent years, the second-generation fuel ethanol produced by using abundant and cheap lignocellulosic raw materials (such as agricultural waste and forestry waste, etc.) is expected to replace non-renewable fossil energy, which can alleviate the current world energy crisis and reduce environmental pollution. wide attention from all over the world. Lignocellulosic raw materials undergo pretreatment, enzymatic hydrolysis and other processes to release sugars such as six-carbon sugars and five-carbon sugars that can be utilized by microorganisms such as Saccharomyces cerevisiae, and also produce various inhibitors, including weak acids, furans and phenolic compounds. [0003] Weak acids mainly include formic acid, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/81C12N15/31C12P7/06C12N1/19C12R1/865
CPCC12N15/81C07K14/395C12P7/06Y02E50/10C12N15/01C12N9/22C12N2500/32C12N2500/34C12N2500/74
Inventor 徐丽丽鲍晓明袁嫒夏天晴王赟韦方卿李在禄
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap