Nanometer antibody targeting porcine pseudorabies virus gD protein, preparation method and application
A porcine pseudorabies virus and nanobody technology, which is applied in the biological field, can solve the problems of no nanobody and no commercial products, and achieve the effects of reducing production cost, simplifying production process and broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Soluble expression and purification of porcine pseudorabies virus gD protein of embodiment 1
[0036]Inoculate PRV HN1201 virus (HN1201 strain (Pseudorabiesvirus, strain HN1201) on the well-growing PK15 cells, the preservation number is CCTCCNO.V201311; preserved in the China Center for Type Culture Collection; the preservation address is Wuhan University, Wuhan, Hubei Province, and the preservation date is 2013 On May 20), using conventional methods in the field to isolate porcine pseudorabies virus genomic DNA as a template, using primers for PCR amplification, using TAKARA's high-fidelity enzyme HS DNA Polymerase with GC Buffer, the amplification conditions are: 94°C 3min; 94°C 30s at ℃, 90s at 68℃, 30cycles; 5min at 72℃. The PCR product was named PRV-gD
[0037] gD upstream amplification primer: GGATCCATGCACGTCGCA (SEQ ID NO.1)
[0038] gD downstream amplification primer: GCGGCCGCCTAGCGACGCGG (SEQ ID NO.2)
[0039] The sequenced correct PCR product PRV-gD was clo...
Embodiment 2
[0040] Example 2 Screening and Identification of Specific Nanobodies Against the gD Protein of PRV
[0041] After the purified soluble PRV-gD protein was fully emulsified with Freund's adjuvant, Bactrian camels were immunized by subcutaneous injection in the neck, and a total of 6 immunizations were carried out at intervals of 2 weeks between each two immunizations. After the sixth immunization, the blood was collected to separate the serum, and the gD protein was used as the antigen to measure the antibody titer and monitor the immune effect. The negative control was the camel serum before immunization, and the centrifuged serum after the immunization was taken, and the antibody titer was detected by ELISA method ( figure 2 ), the results showed that the antibody titer in serum reached 1:256000. Utilize kit (purchased from Invitrogen Company) to extract lymphocyte RNA, use the RNA extracted as template to utilize Oligo(dT)20 primer reverse transcriptase ( III) cDNA is syn...
Embodiment 3
[0042] Example 3 Preparation of PRV-DND-HRP fusion protein
[0043] Utilize primer FDND (SEQ ID NO.4CTGCAGGAAGTACAGCTGGTGGAGTC) and RDND (SEQ ID NO.5GCGGCCGCTTTCAGAACCAGCTTGGTCCC) to connect PRV-DND sequence to pEGFP-N1-HRP carrier (Sheng, Y., et al., Nanobody-horseradish peroxidasefusion protein as an ultrasensitiveprobe to detect antibodies against Newcastle disease virus in the immunoassay.J Nanobiotechnology, 2019.17(1):p.35.), a pEGFP-DND-HRP expression plasmid was constructed, which simultaneously carried a secretion signal peptide, HA tag, and polyclonal Restriction site, PRV-DND, horseradish peroxidase and His tag, after the sequence is correct, save it for later use.
[0044] Take well-conditioned HEK-293T cells and spread them on 6-well plates with a plating density of 2-3×10 5 Cells / ml, 2ml / well, cultivated in a 37°C incubator; when the cells reached 80% confluency under a microscope, transfer pEGFP-DND–HRP into HEK-293T cells (Roche X-tremeGENE HP DNA Transfectio...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


